Incidental Mutation 'R2472:Ptk7'
ID253191
Institutional Source Beutler Lab
Gene Symbol Ptk7
Ensembl Gene ENSMUSG00000023972
Gene NamePTK7 protein tyrosine kinase 7
Synonyms8430404F20Rik, mPTK7/CCK4, chz
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2472 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46564451-46629504 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46576848 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 553 (T553A)
Ref Sequence ENSEMBL: ENSMUSP00000043703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044442]
Predicted Effect probably benign
Transcript: ENSMUST00000044442
AA Change: T553A

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: T553A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,506,252 S291P probably damaging Het
Cbln3 T C 14: 55,884,081 E36G possibly damaging Het
Cdcp1 A G 9: 123,185,107 F201L probably benign Het
Crispld1 A T 1: 17,745,828 R142S probably null Het
Dsc2 T A 18: 20,045,469 M293L probably benign Het
Dzip3 A T 16: 48,953,787 S362T possibly damaging Het
Grm4 C T 17: 27,434,675 C512Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
L1td1 C T 4: 98,733,159 probably benign Het
Nav2 A G 7: 49,408,884 T252A probably benign Het
Neu3 A C 7: 99,813,407 S370A probably damaging Het
Nfasc T A 1: 132,588,221 probably benign Het
Olfr1394 T C 11: 49,160,371 V119A possibly damaging Het
Rap2a T C 14: 120,478,833 I36T possibly damaging Het
Rinl A C 7: 28,790,378 D7A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec16a T C 2: 26,439,936 E689G probably damaging Het
Sec31a T C 5: 100,385,205 I560M probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Setdb2 G A 14: 59,419,454 T138I possibly damaging Het
Sgsh G T 11: 119,355,474 P4Q possibly damaging Het
Slco4a1 G T 2: 180,467,087 W308L probably damaging Het
Ttn T A 2: 76,781,519 R17346S possibly damaging Het
Ubxn4 A G 1: 128,272,869 R366G probably damaging Het
Vmn2r90 T G 17: 17,728,146 N551K probably damaging Het
Other mutations in Ptk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ptk7 APN 17 46574427 missense probably damaging 1.00
IGL01064:Ptk7 APN 17 46573566 nonsense probably null
IGL01444:Ptk7 APN 17 46565387 missense probably damaging 1.00
IGL01477:Ptk7 APN 17 46576880 missense possibly damaging 0.61
IGL01727:Ptk7 APN 17 46572548 missense probably damaging 1.00
IGL01958:Ptk7 APN 17 46579427 missense probably benign 0.37
IGL02496:Ptk7 APN 17 46590144 missense probably benign 0.04
IGL02864:Ptk7 APN 17 46572733 missense probably damaging 1.00
R0008:Ptk7 UTSW 17 46572762 splice site probably benign
R0671:Ptk7 UTSW 17 46590312 missense possibly damaging 0.94
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1549:Ptk7 UTSW 17 46572652 missense probably damaging 1.00
R1635:Ptk7 UTSW 17 46573534 missense possibly damaging 0.81
R1646:Ptk7 UTSW 17 46586297 missense probably benign 0.44
R1846:Ptk7 UTSW 17 46576490 critical splice donor site probably null
R1973:Ptk7 UTSW 17 46586807 nonsense probably null
R2060:Ptk7 UTSW 17 46566238 missense possibly damaging 0.83
R2155:Ptk7 UTSW 17 46579617 missense probably benign 0.09
R2937:Ptk7 UTSW 17 46572550 missense probably damaging 0.99
R3824:Ptk7 UTSW 17 46565378 missense probably damaging 1.00
R3845:Ptk7 UTSW 17 46586418 missense probably benign 0.00
R4222:Ptk7 UTSW 17 46574463 missense probably benign
R4671:Ptk7 UTSW 17 46574466 missense probably benign
R4922:Ptk7 UTSW 17 46576491 critical splice donor site probably null
R5319:Ptk7 UTSW 17 46572677 missense probably damaging 1.00
R5993:Ptk7 UTSW 17 46565370 missense probably benign
R6254:Ptk7 UTSW 17 46572642 missense probably damaging 1.00
R6352:Ptk7 UTSW 17 46576890 missense probably benign 0.00
R6806:Ptk7 UTSW 17 46573528 missense probably damaging 0.99
R7338:Ptk7 UTSW 17 46579599 missense probably benign 0.00
R7394:Ptk7 UTSW 17 46591757 missense probably damaging 1.00
R7709:Ptk7 UTSW 17 46571643 missense possibly damaging 0.81
R7949:Ptk7 UTSW 17 46586461 missense possibly damaging 0.64
R8773:Ptk7 UTSW 17 46566267 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TAGTGAGCAACGGAGCTGTC -3'
(R):5'- TGTTCTGGAGCTGTAAAAGAGG -3'

Sequencing Primer
(F):5'- CGGAAGGTAGGTTGTTACCCC -3'
(R):5'- TAACAGGGGGCTTTGGACCAC -3'
Posted On2014-12-04