Incidental Mutation 'R2473:Mamdc4'
ID253201
Institutional Source Beutler Lab
Gene Symbol Mamdc4
Ensembl Gene ENSMUSG00000026941
Gene NameMAM domain containing 4
SynonymsLOC381352
MMRRC Submission 040404-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2473 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25563115-25574845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25566332 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 713 (G713V)
Ref Sequence ENSEMBL: ENSMUSP00000109861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015236] [ENSMUST00000095117] [ENSMUST00000114223]
Predicted Effect probably benign
Transcript: ENSMUST00000015236
SMART Domains Protein: ENSMUSP00000015236
Gene: ENSMUSG00000015092

DomainStartEndE-ValueType
Pfam:MBF1 4 73 4.6e-29 PFAM
HTH_XRE 80 135 1.02e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095117
AA Change: G717V

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941
AA Change: G717V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114223
AA Change: G713V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941
AA Change: G713V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152124
Predicted Effect unknown
Transcript: ENSMUST00000152237
AA Change: G614V
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941
AA Change: G614V

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153008
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b4 T G 2: 126,358,894 K785Q possibly damaging Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Cyp3a16 T A 5: 145,455,594 I184F possibly damaging Het
Ephb4 T A 5: 137,365,700 D611E probably benign Het
Habp2 G A 19: 56,288,032 V13M possibly damaging Het
Marveld2 C T 13: 100,597,321 V269M probably damaging Het
Mbd5 T A 2: 49,279,341 M1508K probably benign Het
Mgp T C 6: 136,873,164 probably null Het
Mucl2 C G 15: 103,897,362 E110Q possibly damaging Het
Mxra8 T C 4: 155,842,043 F286S probably damaging Het
Olfr1279 T C 2: 111,306,891 S229P probably damaging Het
Olfr325 A G 11: 58,581,575 T244A probably damaging Het
Olfr495 C T 7: 108,395,504 A128V probably damaging Het
Olfr651 T C 7: 104,552,939 Y7H possibly damaging Het
Pax3 C T 1: 78,122,590 probably null Het
Polm T C 11: 5,829,881 E339G possibly damaging Het
Sec14l4 T A 11: 4,043,359 V218E probably benign Het
Sf3b1 C T 1: 54,999,626 probably null Het
Six4 A G 12: 73,104,175 V532A probably benign Het
Slc35c1 T A 2: 92,454,753 D172V probably benign Het
Ttc39a A T 4: 109,442,239 I428F probably damaging Het
Zfp414 CAAACTCTTCCGA CAAACTCTTCCGAAACTCTTCCGA 17: 33,630,577 probably null Het
Other mutations in Mamdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mamdc4 APN 2 25563576 missense possibly damaging 0.53
IGL01994:Mamdc4 APN 2 25568534 missense possibly damaging 0.64
IGL02072:Mamdc4 APN 2 25568339 missense probably damaging 1.00
IGL02193:Mamdc4 APN 2 25564446 missense probably benign 0.02
IGL02673:Mamdc4 APN 2 25570054 missense probably benign
IGL03048:Mamdc4 UTSW 2 25569072 missense possibly damaging 0.67
R0135:Mamdc4 UTSW 2 25566920 missense possibly damaging 0.71
R0481:Mamdc4 UTSW 2 25571216 start codon destroyed probably null 0.08
R0490:Mamdc4 UTSW 2 25563581 missense probably benign 0.01
R0609:Mamdc4 UTSW 2 25564193 missense probably benign 0.30
R0729:Mamdc4 UTSW 2 25570036 missense probably damaging 0.98
R1365:Mamdc4 UTSW 2 25566024 missense probably damaging 1.00
R1533:Mamdc4 UTSW 2 25569747 missense possibly damaging 0.71
R1671:Mamdc4 UTSW 2 25568223 nonsense probably null
R1789:Mamdc4 UTSW 2 25567622 missense possibly damaging 0.59
R2002:Mamdc4 UTSW 2 25567232 missense probably damaging 1.00
R2013:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2014:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2056:Mamdc4 UTSW 2 25564168 missense probably benign 0.18
R2109:Mamdc4 UTSW 2 25569390 missense probably damaging 1.00
R2128:Mamdc4 UTSW 2 25569258 missense probably damaging 1.00
R2185:Mamdc4 UTSW 2 25569692 critical splice donor site probably null
R2496:Mamdc4 UTSW 2 25565902 missense probably damaging 1.00
R3818:Mamdc4 UTSW 2 25565773 missense probably benign
R4591:Mamdc4 UTSW 2 25564597 missense possibly damaging 0.87
R4829:Mamdc4 UTSW 2 25565356 missense possibly damaging 0.85
R4898:Mamdc4 UTSW 2 25570023 missense probably damaging 0.98
R5209:Mamdc4 UTSW 2 25566923 missense probably damaging 0.97
R5268:Mamdc4 UTSW 2 25564690 missense possibly damaging 0.95
R5490:Mamdc4 UTSW 2 25565878 missense probably damaging 1.00
R6152:Mamdc4 UTSW 2 25567439 missense probably damaging 1.00
R6234:Mamdc4 UTSW 2 25570080 missense probably damaging 1.00
R6681:Mamdc4 UTSW 2 25567744 missense probably damaging 1.00
R6774:Mamdc4 UTSW 2 25566936 missense probably benign 0.06
R7178:Mamdc4 UTSW 2 25568965 missense probably benign 0.04
R7225:Mamdc4 UTSW 2 25565546 missense possibly damaging 0.50
R7451:Mamdc4 UTSW 2 25564461 missense possibly damaging 0.80
R7520:Mamdc4 UTSW 2 25565348 missense possibly damaging 0.88
R7627:Mamdc4 UTSW 2 25568213 missense probably damaging 1.00
R7875:Mamdc4 UTSW 2 25568665 nonsense probably null
R7958:Mamdc4 UTSW 2 25568665 nonsense probably null
R8041:Mamdc4 UTSW 2 25564695 missense probably damaging 1.00
R8144:Mamdc4 UTSW 2 25567007 missense probably damaging 0.99
X0022:Mamdc4 UTSW 2 25570192 missense probably damaging 1.00
X0025:Mamdc4 UTSW 2 25564686 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCCCTGCAAAGAAGTGAAGTTTAG -3'
(R):5'- AACTTTGAACGGGACTCCTGC -3'

Sequencing Primer
(F):5'- AGTTTAGACGGGACCAGCC -3'
(R):5'- CTCACAGATGCCCACTGG -3'
Posted On2014-12-04