Incidental Mutation 'R2866:Olfr1089'
ID253202
Institutional Source Beutler Lab
Gene Symbol Olfr1089
Ensembl Gene ENSMUSG00000111711
Gene Nameolfactory receptor 1089
SynonymsMOR193-1, GA_x6K02T2Q125-48226321-48225386
MMRRC Submission 040455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R2866 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86732584-86733701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86733429 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 61 (F61Y)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214317]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099876
AA Change: F61Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097461
Gene: ENSMUSG00000075173
AA Change: F61Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 4.7e-47 PFAM
Pfam:7tm_1 41 290 2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214317
AA Change: F61Y

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Olfr1089
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Olfr1089 APN 2 86733235 missense possibly damaging 0.90
IGL00944:Olfr1089 APN 2 86733561 missense possibly damaging 0.80
IGL01478:Olfr1089 APN 2 86733329 nonsense probably null
IGL01636:Olfr1089 APN 2 86733601 nonsense probably null
IGL01887:Olfr1089 APN 2 86732686 missense probably benign 0.03
IGL02008:Olfr1089 APN 2 86733177 missense possibly damaging 0.90
IGL02470:Olfr1089 APN 2 86733585 missense probably damaging 0.97
IGL02560:Olfr1089 APN 2 86733234 missense probably damaging 1.00
R1782:Olfr1089 UTSW 2 86732682 missense probably benign 0.03
R2234:Olfr1089 UTSW 2 86733577 missense possibly damaging 0.94
R3027:Olfr1089 UTSW 2 86733586 missense possibly damaging 0.79
R4275:Olfr1089 UTSW 2 86733592 missense probably damaging 1.00
R4799:Olfr1089 UTSW 2 86732674 splice site probably null
R5016:Olfr1089 UTSW 2 86732746 missense probably benign 0.17
R5154:Olfr1089 UTSW 2 86732777 nonsense probably null
R5355:Olfr1089 UTSW 2 86733336 missense probably damaging 1.00
R5624:Olfr1089 UTSW 2 86732805 missense probably benign 0.45
R6265:Olfr1089 UTSW 2 86732955 missense probably damaging 0.99
R7382:Olfr1089 UTSW 2 86732785 missense probably benign 0.02
R8009:Olfr1089 UTSW 2 86733504 missense probably damaging 0.99
R8850:Olfr1089 UTSW 2 86732958 missense probably damaging 0.99
X0028:Olfr1089 UTSW 2 86732748 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGTAGAGCAGAGGGTTGC -3'
(R):5'- CATGGAGAGACAGAACTTCACAGTC -3'

Sequencing Primer
(F):5'- TTGCAGATGGCCACATAGTG -3'
(R):5'- GCTGAAGGGTCCATTGTT -3'
Posted On2014-12-04