Incidental Mutation 'R2473:Cyp3a16'
ID253219
Institutional Source Beutler Lab
Gene Symbol Cyp3a16
Ensembl Gene ENSMUSG00000038656
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 16
Synonyms
MMRRC Submission 040404-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R2473 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145436309-145469723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145455594 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 184 (I184F)
Ref Sequence ENSEMBL: ENSMUSP00000031633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031633]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031633
AA Change: I184F

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031633
Gene: ENSMUSG00000038656
AA Change: I184F

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:p450 38 494 5.5e-132 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b4 T G 2: 126,358,894 K785Q possibly damaging Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Ephb4 T A 5: 137,365,700 D611E probably benign Het
Habp2 G A 19: 56,288,032 V13M possibly damaging Het
Mamdc4 C A 2: 25,566,332 G713V probably damaging Het
Marveld2 C T 13: 100,597,321 V269M probably damaging Het
Mbd5 T A 2: 49,279,341 M1508K probably benign Het
Mgp T C 6: 136,873,164 probably null Het
Mucl2 C G 15: 103,897,362 E110Q possibly damaging Het
Mxra8 T C 4: 155,842,043 F286S probably damaging Het
Olfr1279 T C 2: 111,306,891 S229P probably damaging Het
Olfr325 A G 11: 58,581,575 T244A probably damaging Het
Olfr495 C T 7: 108,395,504 A128V probably damaging Het
Olfr651 T C 7: 104,552,939 Y7H possibly damaging Het
Pax3 C T 1: 78,122,590 probably null Het
Polm T C 11: 5,829,881 E339G possibly damaging Het
Sec14l4 T A 11: 4,043,359 V218E probably benign Het
Sf3b1 C T 1: 54,999,626 probably null Het
Six4 A G 12: 73,104,175 V532A probably benign Het
Slc35c1 T A 2: 92,454,753 D172V probably benign Het
Ttc39a A T 4: 109,442,239 I428F probably damaging Het
Zfp414 CAAACTCTTCCGA CAAACTCTTCCGAAACTCTTCCGA 17: 33,630,577 probably null Het
Other mutations in Cyp3a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Cyp3a16 APN 5 145440434 missense probably damaging 0.98
IGL01964:Cyp3a16 APN 5 145455562 missense probably benign 0.41
IGL02007:Cyp3a16 APN 5 145441948 splice site probably benign
IGL02139:Cyp3a16 APN 5 145455480 missense probably benign 0.10
IGL02177:Cyp3a16 APN 5 145450154 missense probably benign 0.43
IGL02407:Cyp3a16 APN 5 145451842 missense probably damaging 0.99
IGL02473:Cyp3a16 APN 5 145440494 missense possibly damaging 0.54
polywog UTSW 5 145467470 nonsense probably null
R0363:Cyp3a16 UTSW 5 145455879 splice site probably benign
R0556:Cyp3a16 UTSW 5 145455980 missense probably benign 0.37
R0557:Cyp3a16 UTSW 5 145469588 missense unknown
R0636:Cyp3a16 UTSW 5 145463085 missense probably benign 0.03
R0749:Cyp3a16 UTSW 5 145456177 critical splice acceptor site probably null
R0788:Cyp3a16 UTSW 5 145465076 missense probably benign 0.00
R1552:Cyp3a16 UTSW 5 145436536 missense probably benign 0.01
R1575:Cyp3a16 UTSW 5 145436457 missense probably benign 0.01
R1580:Cyp3a16 UTSW 5 145442074 missense possibly damaging 0.94
R1580:Cyp3a16 UTSW 5 145442075 missense probably damaging 1.00
R1642:Cyp3a16 UTSW 5 145469589 missense unknown
R1763:Cyp3a16 UTSW 5 145465031 critical splice donor site probably null
R2029:Cyp3a16 UTSW 5 145451857 missense probably damaging 0.96
R2144:Cyp3a16 UTSW 5 145456084 missense probably damaging 1.00
R2409:Cyp3a16 UTSW 5 145440367 missense probably benign 0.01
R2860:Cyp3a16 UTSW 5 145455499 nonsense probably null
R2861:Cyp3a16 UTSW 5 145455499 nonsense probably null
R3747:Cyp3a16 UTSW 5 145442071 missense probably damaging 1.00
R4654:Cyp3a16 UTSW 5 145436457 missense probably benign 0.01
R4781:Cyp3a16 UTSW 5 145456112 missense possibly damaging 0.85
R4873:Cyp3a16 UTSW 5 145452849 missense probably benign 0.01
R4875:Cyp3a16 UTSW 5 145452849 missense probably benign 0.01
R4925:Cyp3a16 UTSW 5 145452834 missense probably benign 0.00
R5365:Cyp3a16 UTSW 5 145452787 missense probably damaging 1.00
R5496:Cyp3a16 UTSW 5 145467531 missense probably damaging 1.00
R5640:Cyp3a16 UTSW 5 145452823 missense possibly damaging 0.94
R5761:Cyp3a16 UTSW 5 145442033 missense possibly damaging 0.79
R6401:Cyp3a16 UTSW 5 145440364 missense probably damaging 1.00
R6526:Cyp3a16 UTSW 5 145455895 missense probably benign 0.01
R6528:Cyp3a16 UTSW 5 145440431 missense probably damaging 1.00
R7000:Cyp3a16 UTSW 5 145463170 critical splice acceptor site probably null
R7268:Cyp3a16 UTSW 5 145467470 nonsense probably null
R7630:Cyp3a16 UTSW 5 145436310 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCACTACAGTTGATCATTTGGGG -3'
(R):5'- ACATGGTCCAGCTGCTTGTC -3'

Sequencing Primer
(F):5'- ACAGTTGATCATTTGGGGAAATTGAG -3'
(R):5'- TGCCCCTTTAGACACTAGATGAC -3'
Posted On2014-12-04