Incidental Mutation 'R2473:Marveld2'
ID253239
Institutional Source Beutler Lab
Gene Symbol Marveld2
Ensembl Gene ENSMUSG00000021636
Gene NameMARVEL (membrane-associating) domain containing 2
SynonymsTric-b, Tricellulin, Tric, Mrvldc2, Tric-c, Tric-a
MMRRC Submission 040404-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2473 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100595957-100616971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100597321 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 269 (V269M)
Ref Sequence ENSEMBL: ENSMUSP00000129990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022137] [ENSMUST00000163163] [ENSMUST00000168772] [ENSMUST00000225754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022137
AA Change: V546M

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022137
Gene: ENSMUSG00000021636
AA Change: V546M

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 4.1e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 2.7e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163163
AA Change: V269M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129990
Gene: ENSMUSG00000021636
AA Change: V269M

DomainStartEndE-ValueType
low complexity region 25 53 N/A INTRINSIC
low complexity region 146 157 N/A INTRINSIC
Pfam:Occludin_ELL 166 268 4.2e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168772
AA Change: V546M

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126438
Gene: ENSMUSG00000021636
AA Change: V546M

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
Pfam:MARVEL 182 358 3.6e-20 PFAM
low complexity region 423 434 N/A INTRINSIC
Pfam:Occludin_ELL 443 545 6.6e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000225754
AA Change: V546M

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein found at the tight junctions between epithelial cells. The encoded protein helps establish epithelial barriers such as those in the organ of Corti, where these barriers are required for normal hearing. Defects in this gene are a cause of deafness autosomal recessive type 49 (DFNB49). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-in mutation fisplay syndromic deafness with rapid progressive degeneration of the hair cells, increased body and organ weights and abnormal tricellular tight junctions. However, vestibular function is intact. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b4 T G 2: 126,358,894 K785Q possibly damaging Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Cyp3a16 T A 5: 145,455,594 I184F possibly damaging Het
Ephb4 T A 5: 137,365,700 D611E probably benign Het
Habp2 G A 19: 56,288,032 V13M possibly damaging Het
Mamdc4 C A 2: 25,566,332 G713V probably damaging Het
Mbd5 T A 2: 49,279,341 M1508K probably benign Het
Mgp T C 6: 136,873,164 probably null Het
Mucl2 C G 15: 103,897,362 E110Q possibly damaging Het
Mxra8 T C 4: 155,842,043 F286S probably damaging Het
Olfr1279 T C 2: 111,306,891 S229P probably damaging Het
Olfr325 A G 11: 58,581,575 T244A probably damaging Het
Olfr495 C T 7: 108,395,504 A128V probably damaging Het
Olfr651 T C 7: 104,552,939 Y7H possibly damaging Het
Pax3 C T 1: 78,122,590 probably null Het
Polm T C 11: 5,829,881 E339G possibly damaging Het
Sec14l4 T A 11: 4,043,359 V218E probably benign Het
Sf3b1 C T 1: 54,999,626 probably null Het
Six4 A G 12: 73,104,175 V532A probably benign Het
Slc35c1 T A 2: 92,454,753 D172V probably benign Het
Ttc39a A T 4: 109,442,239 I428F probably damaging Het
Zfp414 CAAACTCTTCCGA CAAACTCTTCCGAAACTCTTCCGA 17: 33,630,577 probably null Het
Other mutations in Marveld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Marveld2 APN 13 100600893 missense possibly damaging 0.83
IGL00573:Marveld2 APN 13 100597859 splice site probably benign
R1569:Marveld2 UTSW 13 100600998 missense probably benign 0.32
R1884:Marveld2 UTSW 13 100600621 missense probably benign 0.15
R1958:Marveld2 UTSW 13 100597350 missense probably damaging 1.00
R2249:Marveld2 UTSW 13 100612091 missense probably benign
R2258:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2259:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R2260:Marveld2 UTSW 13 100612470 missense probably benign 0.00
R3918:Marveld2 UTSW 13 100611893 missense probably benign 0.01
R4010:Marveld2 UTSW 13 100611428 splice site probably null
R4089:Marveld2 UTSW 13 100600480 missense probably benign 0.04
R4634:Marveld2 UTSW 13 100611939 missense probably damaging 1.00
R4775:Marveld2 UTSW 13 100616795 unclassified probably benign
R4961:Marveld2 UTSW 13 100611923 missense probably benign 0.12
R5424:Marveld2 UTSW 13 100612187 missense probably benign
R5546:Marveld2 UTSW 13 100600938 missense probably benign 0.14
R5900:Marveld2 UTSW 13 100611668 missense probably damaging 1.00
R5977:Marveld2 UTSW 13 100611689 missense possibly damaging 0.87
R6177:Marveld2 UTSW 13 100597378 missense probably damaging 0.99
R7409:Marveld2 UTSW 13 100611476 missense probably damaging 0.99
R7484:Marveld2 UTSW 13 100611560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCAAGCCCTTGTTCATCAG -3'
(R):5'- TCAGCAGTTTTCCTTGAGGATG -3'

Sequencing Primer
(F):5'- TATCCCAGCTGAATACGCTG -3'
(R):5'- AGGATGTGTTTGTGTTAACCAC -3'
Posted On2014-12-04