Incidental Mutation 'R2473:Zfp414'
ID 253243
Institutional Source Beutler Lab
Gene Symbol Zfp414
Ensembl Gene ENSMUSG00000073423
Gene Name zinc finger protein 414
Synonyms
MMRRC Submission 040404-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock # R2473 (G1)
Quality Score 126
Status Not validated
Chromosome 17
Chromosomal Location 33629090-33631779 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) CAAACTCTTCCGA to CAAACTCTTCCGAAACTCTTCCGA at 33630577 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073570] [ENSMUST00000165504] [ENSMUST00000166627] [ENSMUST00000170225]
AlphaFold Q9DCK4
Predicted Effect probably null
Transcript: ENSMUST00000073570
SMART Domains Protein: ENSMUSP00000073259
Gene: ENSMUSG00000073423

DomainStartEndE-ValueType
low complexity region 86 95 N/A INTRINSIC
ZnF_C2H2 99 123 1.01e-1 SMART
ZnF_C2H2 135 159 7.49e0 SMART
ZnF_C2H2 166 191 2.61e1 SMART
low complexity region 195 231 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164636
Predicted Effect probably benign
Transcript: ENSMUST00000165504
Predicted Effect probably null
Transcript: ENSMUST00000166627
SMART Domains Protein: ENSMUSP00000129423
Gene: ENSMUSG00000073423

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
ZnF_C2H2 50 74 1.01e-1 SMART
ZnF_C2H2 86 110 7.49e0 SMART
ZnF_C2H2 117 142 2.61e1 SMART
low complexity region 146 182 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169781
Predicted Effect probably null
Transcript: ENSMUST00000170225
SMART Domains Protein: ENSMUSP00000127118
Gene: ENSMUSG00000073423

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
ZnF_C2H2 50 74 1.01e-1 SMART
ZnF_C2H2 86 110 7.49e0 SMART
ZnF_C2H2 117 142 2.61e1 SMART
low complexity region 146 182 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172455
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b4 T G 2: 126,358,894 K785Q possibly damaging Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Cyp3a16 T A 5: 145,455,594 I184F possibly damaging Het
Ephb4 T A 5: 137,365,700 D611E probably benign Het
Habp2 G A 19: 56,288,032 V13M possibly damaging Het
Mamdc4 C A 2: 25,566,332 G713V probably damaging Het
Marveld2 C T 13: 100,597,321 V269M probably damaging Het
Mbd5 T A 2: 49,279,341 M1508K probably benign Het
Mgp T C 6: 136,873,164 probably null Het
Mucl2 C G 15: 103,897,362 E110Q possibly damaging Het
Mxra8 T C 4: 155,842,043 F286S probably damaging Het
Olfr1279 T C 2: 111,306,891 S229P probably damaging Het
Olfr325 A G 11: 58,581,575 T244A probably damaging Het
Olfr495 C T 7: 108,395,504 A128V probably damaging Het
Olfr651 T C 7: 104,552,939 Y7H possibly damaging Het
Pax3 C T 1: 78,122,590 probably null Het
Polm T C 11: 5,829,881 E339G possibly damaging Het
Sec14l4 T A 11: 4,043,359 V218E probably benign Het
Sf3b1 C T 1: 54,999,626 probably null Het
Six4 A G 12: 73,104,175 V532A probably benign Het
Slc35c1 T A 2: 92,454,753 D172V probably benign Het
Ttc39a A T 4: 109,442,239 I428F probably damaging Het
Other mutations in Zfp414
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1277:Zfp414 UTSW 17 33630475 critical splice donor site probably null
R1453:Zfp414 UTSW 17 33630038 missense probably damaging 1.00
R3697:Zfp414 UTSW 17 33630577 frame shift probably null
R4545:Zfp414 UTSW 17 33631648 unclassified probably benign
R5610:Zfp414 UTSW 17 33630038 missense probably damaging 1.00
R7265:Zfp414 UTSW 17 33631279 missense probably benign 0.02
R7836:Zfp414 UTSW 17 33629988 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCAGTGTTCGTGATCTAGC -3'
(R):5'- ACCACGGCATGTATACCCTG -3'

Sequencing Primer
(F):5'- CAGTGTTCGTGATCTAGCACAGC -3'
(R):5'- GCCAGAATGACTTAATTCCCATCTG -3'
Posted On 2014-12-04