Incidental Mutation 'R2474:Itpkb'
ID253251
Institutional Source Beutler Lab
Gene Symbol Itpkb
Ensembl Gene ENSMUSG00000038855
Gene Nameinositol 1,4,5-trisphosphate 3-kinase B
Synonyms
MMRRC Submission 040405-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R2474 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180330485-180424802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180334151 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 614 (D614G)
Ref Sequence ENSEMBL: ENSMUSP00000069851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070181]
PDB Structure
Crystal Structure of the Catalytic and CaM-Binding domains of Inositol 1,4,5-Trisphosphate 3-Kinase B [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050581
SMART Domains Protein: ENSMUSP00000050698
Gene: ENSMUSG00000055676

DomainStartEndE-ValueType
Gp_dh_N 2 154 5.53e-95 SMART
Pfam:Gp_dh_C 159 316 5.8e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070181
AA Change: D614G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069851
Gene: ENSMUSG00000038855
AA Change: D614G

DomainStartEndE-ValueType
low complexity region 68 106 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
low complexity region 595 618 N/A INTRINSIC
Pfam:IPK 722 933 3.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195043
Meta Mutation Damage Score 0.404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this protein regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of this encoded protein is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Both calcium/calmodulin and protein phosphorylation mechanisms control its activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a block of thymocyte development at the double positive stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,542,724 T678A probably benign Het
Asb7 A T 7: 66,679,153 N46K probably damaging Het
Atxn7l2 A C 3: 108,203,977 S414R probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cxcl13 C T 5: 95,959,957 Q91* probably null Het
Dchs1 T C 7: 105,755,074 N2754D probably benign Het
Dchs1 A T 7: 105,772,838 V125E probably damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Greb1 T C 12: 16,714,953 N393S possibly damaging Het
Hfm1 A T 5: 106,872,416 V1048D possibly damaging Het
Ilvbl T C 10: 78,576,724 V93A probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgi3 G A 14: 70,533,249 probably null Het
Mpeg1 G A 19: 12,462,249 C357Y probably damaging Het
Nedd1 A G 10: 92,719,603 F7L probably damaging Het
Olfr1082 C A 2: 86,594,613 V72F probably benign Het
Olfr943 A G 9: 39,184,550 D121G probably damaging Het
Parp8 A T 13: 116,893,041 C510S possibly damaging Het
Phb T C 11: 95,671,422 F42L possibly damaging Het
Pik3r1 A T 13: 101,702,776 Y189* probably null Het
Rps5 T A 7: 12,926,561 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp3 T A 11: 69,674,097 N516Y probably damaging Het
Tfap2b A T 1: 19,214,375 H169L possibly damaging Het
Tmem260 A G 14: 48,496,324 D226G probably null Het
Ttc6 G T 12: 57,575,927 R37S probably benign Het
Vmn2r84 A T 10: 130,386,523 D609E possibly damaging Het
Vmn2r99 A T 17: 19,378,629 M192L probably benign Het
Zfp746 T C 6: 48,064,769 D341G probably damaging Het
Zfp941 A T 7: 140,811,471 H658Q probably damaging Het
Zw10 T A 9: 49,066,805 I351N probably damaging Het
Other mutations in Itpkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Itpkb APN 1 180332993 missense probably benign
IGL01733:Itpkb APN 1 180333169 missense possibly damaging 0.50
IGL01812:Itpkb APN 1 180420286 missense probably damaging 1.00
IGL01965:Itpkb APN 1 180332405 missense probably damaging 1.00
IGL02447:Itpkb APN 1 180421354 splice site probably benign
IGL03143:Itpkb APN 1 180333368 missense probably benign
IGL03228:Itpkb APN 1 180413999 missense probably damaging 1.00
lahar UTSW 1 180327225 unclassified probably benign
magma UTSW 1 180413975 missense probably damaging 1.00
Purpura UTSW 1 180334096 missense probably damaging 1.00
Pyroclastic UTSW 1 180334253 intron probably benign
volcano UTSW 1 180421315 missense probably damaging 1.00
IGL02991:Itpkb UTSW 1 180327714 unclassified probably benign
R0071:Itpkb UTSW 1 180332765 missense probably damaging 1.00
R0471:Itpkb UTSW 1 180418255 missense probably damaging 0.98
R0616:Itpkb UTSW 1 180421736 missense probably damaging 1.00
R1567:Itpkb UTSW 1 180421858 missense probably benign 0.00
R2060:Itpkb UTSW 1 180421858 missense probably benign 0.00
R3022:Itpkb UTSW 1 180418323 missense probably damaging 0.96
R3792:Itpkb UTSW 1 180333173 missense possibly damaging 0.81
R3831:Itpkb UTSW 1 180333695 missense probably benign 0.00
R3833:Itpkb UTSW 1 180333695 missense probably benign 0.00
R3967:Itpkb UTSW 1 180327798 unclassified probably benign
R3968:Itpkb UTSW 1 180327798 unclassified probably benign
R4735:Itpkb UTSW 1 180418215 missense probably damaging 1.00
R4774:Itpkb UTSW 1 180418194 missense probably damaging 1.00
R4807:Itpkb UTSW 1 180334875 intron probably benign
R4895:Itpkb UTSW 1 180413895 missense probably damaging 1.00
R5514:Itpkb UTSW 1 180413909 missense probably damaging 1.00
R5593:Itpkb UTSW 1 180334096 missense probably damaging 1.00
R5633:Itpkb UTSW 1 180327225 unclassified probably benign
R5772:Itpkb UTSW 1 180334253 intron probably benign
R5898:Itpkb UTSW 1 180421315 missense probably damaging 1.00
R5903:Itpkb UTSW 1 180413975 missense probably damaging 1.00
R7060:Itpkb UTSW 1 180333130 missense probably damaging 1.00
X0066:Itpkb UTSW 1 180421780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTTAAAAGAGGCCTGCAG -3'
(R):5'- TTGGTAGACCATGCCCACAAC -3'

Sequencing Primer
(F):5'- TGCAGCCCCAGCAACATC -3'
(R):5'- ATTATGACTTTACCAGAGCCCTG -3'
Posted On2014-12-04