Incidental Mutation 'R2866:Sorl1'
ID 253262
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms 2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission 040455-MU
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock # R2866 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 41964720-42124297 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41969781 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 2148 (I2148T)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect probably benign
Transcript: ENSMUST00000060989
AA Change: I2148T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: I2148T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134560
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
R7272:Sorl1 UTSW 9 42063710 splice site probably null
R7537:Sorl1 UTSW 9 41980688 missense probably benign 0.01
R7615:Sorl1 UTSW 9 41977582 missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42092334 missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41984526 missense probably damaging 1.00
R7763:Sorl1 UTSW 9 42043909 missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42089961 missense probably benign 0.17
R7956:Sorl1 UTSW 9 41989359 missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41991401 missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R8151:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R8219:Sorl1 UTSW 9 42041561 splice site probably null
R8261:Sorl1 UTSW 9 42014481 missense probably damaging 1.00
R8283:Sorl1 UTSW 9 42030998 missense probably damaging 1.00
R8308:Sorl1 UTSW 9 42018160 missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41991745 missense probably benign 0.35
R8448:Sorl1 UTSW 9 41991745 missense probably benign 0.35
R8524:Sorl1 UTSW 9 41974074 missense probably damaging 1.00
R8869:Sorl1 UTSW 9 42022426 missense probably benign 0.01
R8898:Sorl1 UTSW 9 42000271 missense probably damaging 1.00
R8972:Sorl1 UTSW 9 42046552 missense probably damaging 1.00
R9012:Sorl1 UTSW 9 42071195 missense probably damaging 1.00
R9094:Sorl1 UTSW 9 42063754 missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41974124 nonsense probably null
R9278:Sorl1 UTSW 9 42046561 missense probably benign 0.01
R9288:Sorl1 UTSW 9 42041631 missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41989443 missense probably damaging 1.00
R9330:Sorl1 UTSW 9 42067933 missense probably damaging 1.00
R9332:Sorl1 UTSW 9 42001518 missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42099203 missense possibly damaging 0.64
Z1176:Sorl1 UTSW 9 42123948 missense probably benign 0.03
Z1177:Sorl1 UTSW 9 41991638 missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42106541 missense probably benign 0.00
Z1177:Sorl1 UTSW 9 42123912 missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTTCGTGGTGCTCATTTG -3'
(R):5'- GAATGCTTGTAAACACTGGGC -3'

Sequencing Primer
(F):5'- GTGCTCATTTGCCCCCGG -3'
(R):5'- TTCTATTTTGGTGGGTGGGC -3'
Posted On 2014-12-04