Incidental Mutation 'R2474:Cxcl13'
ID 253263
Institutional Source Beutler Lab
Gene Symbol Cxcl13
Ensembl Gene ENSMUSG00000023078
Gene Name chemokine (C-X-C motif) ligand 13
Synonyms ANGIE2, 4631412M08Rik, BLC, Scyb13, BCA-1
MMRRC Submission 040405-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2474 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 95956951-95961068 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 95959957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 91 (Q91*)
Ref Sequence ENSEMBL: ENSMUSP00000023840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023840]
AlphaFold O55038
Predicted Effect probably null
Transcript: ENSMUST00000023840
AA Change: Q91*
SMART Domains Protein: ENSMUSP00000023840
Gene: ENSMUSG00000023078
AA Change: Q91*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCY 29 90 4.14e-11 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B lymphocyte chemoattractant, independently cloned and named Angie, is an antimicrobial peptide and CXC chemokine strongly expressed in the follicles of the spleen, lymph nodes, and Peyer's patches. It preferentially promotes the migration of B lymphocytes (compared to T cells and macrophages), apparently by stimulating calcium influx into, and chemotaxis of, cells expressing Burkitt's lymphoma receptor 1 (BLR-1). It may therefore function in the homing of B lymphocytes to follicles. [provided by RefSeq, Oct 2014]
PHENOTYPE: B lymphocyte trafficking is impaired in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,542,724 T678A probably benign Het
Asb7 A T 7: 66,679,153 N46K probably damaging Het
Atxn7l2 A C 3: 108,203,977 S414R probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Dchs1 T C 7: 105,755,074 N2754D probably benign Het
Dchs1 A T 7: 105,772,838 V125E probably damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Greb1 T C 12: 16,714,953 N393S possibly damaging Het
Hfm1 A T 5: 106,872,416 V1048D possibly damaging Het
Ilvbl T C 10: 78,576,724 V93A probably damaging Het
Itpkb A G 1: 180,334,151 D614G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgi3 G A 14: 70,533,249 probably null Het
Mpeg1 G A 19: 12,462,249 C357Y probably damaging Het
Nedd1 A G 10: 92,719,603 F7L probably damaging Het
Olfr1082 C A 2: 86,594,613 V72F probably benign Het
Olfr943 A G 9: 39,184,550 D121G probably damaging Het
Parp8 A T 13: 116,893,041 C510S possibly damaging Het
Phb T C 11: 95,671,422 F42L possibly damaging Het
Pik3r1 A T 13: 101,702,776 Y189* probably null Het
Rps5 T A 7: 12,926,561 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp3 T A 11: 69,674,097 N516Y probably damaging Het
Tfap2b A T 1: 19,214,375 H169L possibly damaging Het
Tmem260 A G 14: 48,496,324 D226G probably null Het
Ttc6 G T 12: 57,575,927 R37S probably benign Het
Vmn2r84 A T 10: 130,386,523 D609E possibly damaging Het
Vmn2r99 A T 17: 19,378,629 M192L probably benign Het
Zfp746 T C 6: 48,064,769 D341G probably damaging Het
Zfp941 A T 7: 140,811,471 H658Q probably damaging Het
Zw10 T A 9: 49,066,805 I351N probably damaging Het
Other mutations in Cxcl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
ice UTSW 5 95958671 missense probably damaging 1.00
pick UTSW 5 95958727 missense probably benign 0.13
Sleet UTSW 5 95957002 missense unknown
R0709:Cxcl13 UTSW 5 95958671 missense probably damaging 1.00
R1669:Cxcl13 UTSW 5 95958741 missense probably damaging 0.97
R4746:Cxcl13 UTSW 5 95959897 missense probably damaging 1.00
R5278:Cxcl13 UTSW 5 95958727 missense probably benign 0.13
R5457:Cxcl13 UTSW 5 95956971 start codon destroyed unknown
R8055:Cxcl13 UTSW 5 95959904 missense probably benign 0.08
R8854:Cxcl13 UTSW 5 95957002 missense unknown
R9421:Cxcl13 UTSW 5 95959930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATAATAGTCTTCTTGTTCCTCAGGC -3'
(R):5'- CTGCTGTGCACACTAGCTTC -3'

Sequencing Primer
(F):5'- GTTCCTCAGGCCTCACACCAC -3'
(R):5'- GTGCACACTAGCTTCAGTTTAC -3'
Posted On 2014-12-04