Incidental Mutation 'R2474:Nedd1'
ID 253287
Institutional Source Beutler Lab
Gene Symbol Nedd1
Ensembl Gene ENSMUSG00000019988
Gene Name neural precursor cell expressed, developmentally down-regulated gene 1
Synonyms
MMRRC Submission 040405-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R2474 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 92684746-92722420 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92719603 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 7 (F7L)
Ref Sequence ENSEMBL: ENSMUSP00000150817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020163] [ENSMUST00000216086]
AlphaFold P33215
Predicted Effect possibly damaging
Transcript: ENSMUST00000020163
AA Change: F7L

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988
AA Change: F7L

DomainStartEndE-ValueType
WD40 21 63 5.97e-1 SMART
WD40 67 105 9.75e-3 SMART
WD40 108 147 6.19e-5 SMART
WD40 149 191 6.42e-1 SMART
WD40 194 235 9.1e-3 SMART
WD40 238 276 2.24e-2 SMART
low complexity region 555 568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215970
Predicted Effect probably damaging
Transcript: ENSMUST00000216086
AA Change: F7L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.0999 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,542,724 T678A probably benign Het
Asb7 A T 7: 66,679,153 N46K probably damaging Het
Atxn7l2 A C 3: 108,203,977 S414R probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cxcl13 C T 5: 95,959,957 Q91* probably null Het
Dchs1 T C 7: 105,755,074 N2754D probably benign Het
Dchs1 A T 7: 105,772,838 V125E probably damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Greb1 T C 12: 16,714,953 N393S possibly damaging Het
Hfm1 A T 5: 106,872,416 V1048D possibly damaging Het
Ilvbl T C 10: 78,576,724 V93A probably damaging Het
Itpkb A G 1: 180,334,151 D614G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgi3 G A 14: 70,533,249 probably null Het
Mpeg1 G A 19: 12,462,249 C357Y probably damaging Het
Olfr1082 C A 2: 86,594,613 V72F probably benign Het
Olfr943 A G 9: 39,184,550 D121G probably damaging Het
Parp8 A T 13: 116,893,041 C510S possibly damaging Het
Phb T C 11: 95,671,422 F42L possibly damaging Het
Pik3r1 A T 13: 101,702,776 Y189* probably null Het
Rps5 T A 7: 12,926,561 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp3 T A 11: 69,674,097 N516Y probably damaging Het
Tfap2b A T 1: 19,214,375 H169L possibly damaging Het
Tmem260 A G 14: 48,496,324 D226G probably null Het
Ttc6 G T 12: 57,575,927 R37S probably benign Het
Vmn2r84 A T 10: 130,386,523 D609E possibly damaging Het
Vmn2r99 A T 17: 19,378,629 M192L probably benign Het
Zfp746 T C 6: 48,064,769 D341G probably damaging Het
Zfp941 A T 7: 140,811,471 H658Q probably damaging Het
Zw10 T A 9: 49,066,805 I351N probably damaging Het
Other mutations in Nedd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Nedd1 APN 10 92694974 splice site probably benign
IGL00988:Nedd1 APN 10 92689686 missense possibly damaging 0.71
IGL01563:Nedd1 APN 10 92698169 critical splice donor site probably null
IGL01588:Nedd1 APN 10 92686262 missense probably benign 0.12
IGL01988:Nedd1 APN 10 92714159 missense probably benign 0.39
IGL02706:Nedd1 APN 10 92686285 missense possibly damaging 0.88
IGL02938:Nedd1 APN 10 92689657 nonsense probably null
IGL03011:Nedd1 APN 10 92689641 missense possibly damaging 0.92
Brainless UTSW 10 92690773 missense probably benign 0.01
R0125:Nedd1 UTSW 10 92691929 missense possibly damaging 0.93
R0173:Nedd1 UTSW 10 92698883 missense probably benign 0.30
R0244:Nedd1 UTSW 10 92716265 intron probably benign
R0645:Nedd1 UTSW 10 92691831 splice site probably null
R0791:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1490:Nedd1 UTSW 10 92700798 missense probably damaging 1.00
R1522:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1797:Nedd1 UTSW 10 92698739 missense possibly damaging 0.46
R1984:Nedd1 UTSW 10 92714160 missense possibly damaging 0.63
R2877:Nedd1 UTSW 10 92714126 missense possibly damaging 0.89
R2883:Nedd1 UTSW 10 92694998 missense probably damaging 0.98
R4694:Nedd1 UTSW 10 92719582 missense probably benign 0.00
R4798:Nedd1 UTSW 10 92698910 missense probably benign 0.00
R4830:Nedd1 UTSW 10 92686258 missense probably damaging 1.00
R4963:Nedd1 UTSW 10 92695031 missense probably damaging 1.00
R5174:Nedd1 UTSW 10 92711212 missense possibly damaging 0.77
R5329:Nedd1 UTSW 10 92686240 missense probably damaging 1.00
R5404:Nedd1 UTSW 10 92716192 missense probably benign 0.04
R5534:Nedd1 UTSW 10 92695032 missense probably benign 0.01
R6045:Nedd1 UTSW 10 92695100 nonsense probably null
R6154:Nedd1 UTSW 10 92698242 missense possibly damaging 0.65
R6512:Nedd1 UTSW 10 92691875 missense probably benign
R6692:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6693:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6943:Nedd1 UTSW 10 92711306 missense probably damaging 1.00
R7011:Nedd1 UTSW 10 92690773 missense probably benign 0.01
R7406:Nedd1 UTSW 10 92711323 splice site probably null
R7455:Nedd1 UTSW 10 92700925 missense probably benign 0.01
R7587:Nedd1 UTSW 10 92698730 missense probably benign 0.01
R7745:Nedd1 UTSW 10 92714172 missense probably benign
R8104:Nedd1 UTSW 10 92691916 missense probably damaging 1.00
R8209:Nedd1 UTSW 10 92691935 missense probably benign
R8226:Nedd1 UTSW 10 92691935 missense probably benign
R8925:Nedd1 UTSW 10 92722396 start gained probably benign
R8927:Nedd1 UTSW 10 92722396 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCCAACAGTTTCACAG -3'
(R):5'- TCTTGGAAGGATGAGCTAAGTG -3'

Sequencing Primer
(F):5'- GGGCCAACAGTTTCACAGATCATTG -3'
(R):5'- GCTGGTGTTTGAGTCACTCATAC -3'
Posted On 2014-12-04