Incidental Mutation 'R0313:Ncf1'
ID25329
Institutional Source Beutler Lab
Gene Symbol Ncf1
Ensembl Gene ENSMUSG00000015950
Gene Nameneutrophil cytosolic factor 1
Synonymsp47, Ncf-1, NOXO2, NADPH oxidase subunit (47kDa), p47phox
MMRRC Submission 038523-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0313 (G1)
Quality Score201
Status Validated
Chromosome5
Chromosomal Location134220053-134229625 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 134229567 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000138547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016094] [ENSMUST00000111275] [ENSMUST00000144086] [ENSMUST00000146354]
Predicted Effect probably null
Transcript: ENSMUST00000016094
AA Change: M1V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000016094
Gene: ENSMUSG00000015950
AA Change: M1V

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 403 1.3e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111275
AA Change: M1V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106906
Gene: ENSMUSG00000015950
AA Change: M1V

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139249
Predicted Effect probably null
Transcript: ENSMUST00000144086
AA Change: M1V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138547
Gene: ENSMUSG00000015950
AA Change: M1V

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
low complexity region 336 344 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146354
AA Change: M1V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138121
Gene: ENSMUSG00000015950
AA Change: M1V

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Meta Mutation Damage Score 0.9538 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.9%
  • 20x: 88.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene causes severe spontaneous infections and granulomatous inflammation and may alter synaptic plasticity and memory, RAS activation, blood pressure control, airway smooth muscle function, neointima formation, vasoconstriction and the response to myocardial infarction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 A G 6: 58,672,097 E309G probably benign Het
AI314180 A G 4: 58,811,892 I1411T probably benign Het
Ankmy1 C T 1: 92,886,221 G412D probably damaging Het
Cc2d1a G A 8: 84,136,969 T542I probably benign Het
Cldn18 T C 9: 99,698,914 I94V probably benign Het
Cobll1 G A 2: 65,095,744 R1195* probably null Het
Dnah7b A G 1: 46,207,643 T1660A probably damaging Het
Dzip3 G T 16: 48,937,061 Q870K probably damaging Het
Ebf4 T C 2: 130,306,787 probably benign Het
Esyt2 T C 12: 116,347,808 L439P probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Haspin A G 11: 73,136,298 V655A probably damaging Het
Kmt2c T C 5: 25,344,930 E1351G probably damaging Het
Lama2 C A 10: 26,993,398 probably null Het
Lcp1 A G 14: 75,199,433 E73G probably damaging Het
Ltv1 C T 10: 13,182,860 probably null Het
Mcmdc2 A G 1: 9,932,141 Y529C probably damaging Het
Myo3b T A 2: 70,348,959 Y1172* probably null Het
Olfr1297 C T 2: 111,621,600 S158N possibly damaging Het
Olfr250 T C 9: 38,368,304 S243P probably damaging Het
Olfr765 A G 10: 129,046,826 V79A possibly damaging Het
Pcif1 A T 2: 164,884,419 H80L probably damaging Het
Pclo T C 5: 14,678,873 probably benign Het
Polr2a T C 11: 69,735,080 Y1710C unknown Het
Ppp1r37 G A 7: 19,533,998 T324I probably damaging Het
Prmt1 T C 7: 44,978,748 D176G probably benign Het
Scn5a T C 9: 119,534,571 D501G probably damaging Het
Ska2 A G 11: 87,117,814 I89M possibly damaging Het
Slc39a7 G A 17: 34,029,544 A375V probably damaging Het
Ssrp1 T A 2: 85,041,554 I374N probably damaging Het
Stox2 C T 8: 47,192,134 G828R probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Uqcrc1 C A 9: 108,948,574 R114S possibly damaging Het
Usp38 A T 8: 80,984,442 L988* probably null Het
Vmn2r5 T A 3: 64,503,827 H440L probably benign Het
Wdr12 A T 1: 60,082,579 I271N possibly damaging Het
Xylt2 C T 11: 94,669,894 probably benign Het
Other mutations in Ncf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Ncf1 APN 5 134226593 missense probably benign 0.03
IGL02718:Ncf1 APN 5 134227448 critical splice donor site probably null
R0143:Ncf1 UTSW 5 134227137 splice site probably benign
R0413:Ncf1 UTSW 5 134222802 splice site probably benign
R2037:Ncf1 UTSW 5 134229552 missense probably damaging 1.00
R2042:Ncf1 UTSW 5 134226640 missense probably benign 0.00
R2511:Ncf1 UTSW 5 134225698 missense probably damaging 0.99
R3545:Ncf1 UTSW 5 134226609 nonsense probably null
R3547:Ncf1 UTSW 5 134226609 nonsense probably null
R3548:Ncf1 UTSW 5 134226609 nonsense probably null
R4751:Ncf1 UTSW 5 134229545 missense probably damaging 1.00
R4989:Ncf1 UTSW 5 134223413 missense probably damaging 0.98
R5288:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5384:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5385:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5590:Ncf1 UTSW 5 134223501 missense probably damaging 0.98
R6059:Ncf1 UTSW 5 134223487 missense probably damaging 1.00
R6136:Ncf1 UTSW 5 134226633 missense probably damaging 1.00
R7023:Ncf1 UTSW 5 134225262 missense possibly damaging 0.48
R7310:Ncf1 UTSW 5 134221761 missense probably benign 0.04
R7618:Ncf1 UTSW 5 134227267 missense probably benign 0.08
R7838:Ncf1 UTSW 5 134222095 missense possibly damaging 0.55
R7921:Ncf1 UTSW 5 134222095 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CCTGTGCCTGAGAGGTCCCC -3'
(R):5'- GCTGCCCCACCACTCTGTTGAA -3'

Sequencing Primer
(F):5'- tcccccctccctctcac -3'
(R):5'- CCACTCTGTTGAAGCTCAAAAATTC -3'
Posted On2013-04-16