Mutagenetix > Incidental Mutation

Incidental Mutation 'R2474:Senp3'

253291

Institutional Source

Beutler Lab

Gene Symbol

Senp3

Ensembl Gene

ENSMUSG00000005204

Gene Name

SUMO/sentrin specific peptidase 3

Synonyms

Smt3ip1

MMRRC Submission

040405-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.661) question?

Stock #

R2474 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69563941-69572910 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 69564923 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 516 (N516Y)

Ref Sequence

ENSEMBL: ENSMUSP00000066581 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005336] [ENSMUST00000066760] [ENSMUST00000102589] [ENSMUST00000163666]

AlphaFold

Q9EP97

Predicted Effect

probably damaging
Transcript: ENSMUST00000005336
AA Change: N516Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000005336
Gene: ENSMUSG00000005204
AA Change: N516Y

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
low complexity region	42	53	N/A	INTRINSIC
low complexity region	74	86	N/A	INTRINSIC
low complexity region	118	131	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
Pfam:Peptidase_C48	394	566	4.9e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000066760
AA Change: N516Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066581
Gene: ENSMUSG00000005204
AA Change: N516Y

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
low complexity region	42	53	N/A	INTRINSIC
low complexity region	74	86	N/A	INTRINSIC
low complexity region	118	131	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
Pfam:Peptidase_C48	394	566	4.9e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102589

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122759

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123084

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123995

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127677

Predicted Effect

unknown
Transcript: ENSMUST00000134942
AA Change: N116Y

SMART Domains

Protein: ENSMUSP00000114791
Gene: ENSMUSG00000005204
AA Change: N116Y

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C48	5	167	4.1e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142206

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153516

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140310

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135372

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142214

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129295

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139299

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145289

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128355

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130440

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128519

Predicted Effect

probably benign
Transcript: ENSMUST00000163666

SMART Domains

Protein: ENSMUSP00000127034
Gene: ENSMUSG00000059796

Domain	Start	End	E-Value	Type
DEXDc	51	249	3.61e-60	SMART
HELICc	286	367	1.04e-33	SMART

Meta Mutation Damage Score

0.5599

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 94.9%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP3, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl4	A	G	3: 151,248,361 (GRCm39)	T678A	probably benign	Het
Asb7	A	T	7: 66,328,901 (GRCm39)	N46K	probably damaging	Het
Atxn7l2	A	C	3: 108,111,293 (GRCm39)	S414R	probably damaging	Het
Bckdk	C	A	7: 127,504,590 (GRCm39)	R105S	probably damaging	Het
Cxcl13	C	T	5: 96,107,816 (GRCm39)	Q91*	probably null	Het
Dchs1	T	C	7: 105,404,281 (GRCm39)	N2754D	probably benign	Het
Dchs1	A	T	7: 105,422,045 (GRCm39)	V125E	probably damaging	Het
Enpep	G	C	3: 129,077,807 (GRCm39)	S603R	possibly damaging	Het
Greb1	T	C	12: 16,764,954 (GRCm39)	N393S	possibly damaging	Het
Hfm1	A	T	5: 107,020,282 (GRCm39)	V1048D	possibly damaging	Het
Ilvbl	T	C	10: 78,412,558 (GRCm39)	V93A	probably damaging	Het
Itpkb	A	G	1: 180,161,716 (GRCm39)	D614G	probably damaging	Het
Klk14	G	A	7: 43,341,501 (GRCm39)	C51Y	probably damaging	Het
Lgi3	G	A	14: 70,770,689 (GRCm39)		probably null	Het
Mpeg1	G	A	19: 12,439,613 (GRCm39)	C357Y	probably damaging	Het
Nedd1	A	G	10: 92,555,465 (GRCm39)	F7L	probably damaging	Het
Or8g26	A	G	9: 39,095,846 (GRCm39)	D121G	probably damaging	Het
Or8k35	C	A	2: 86,424,957 (GRCm39)	V72F	probably benign	Het
Parp8	A	T	13: 117,029,577 (GRCm39)	C510S	possibly damaging	Het
Phb1	T	C	11: 95,562,248 (GRCm39)	F42L	possibly damaging	Het
Pik3r1	A	T	13: 101,839,284 (GRCm39)	Y189*	probably null	Het
Rps5	T	A	7: 12,660,488 (GRCm39)		probably null	Het
Secisbp2l	C	T	2: 125,582,657 (GRCm39)	G933D	possibly damaging	Het
Tfap2b	A	T	1: 19,284,599 (GRCm39)	H169L	possibly damaging	Het
Tmem260	A	G	14: 48,733,781 (GRCm39)	D226G	probably null	Het
Ttc6	G	T	12: 57,622,713 (GRCm39)	R37S	probably benign	Het
Vmn2r84	A	T	10: 130,222,392 (GRCm39)	D609E	possibly damaging	Het
Vmn2r99	A	T	17: 19,598,891 (GRCm39)	M192L	probably benign	Het
Zfp746	T	C	6: 48,041,703 (GRCm39)	D341G	probably damaging	Het
Zfp941	A	T	7: 140,391,384 (GRCm39)	H658Q	probably damaging	Het
Zw10	T	A	9: 48,978,105 (GRCm39)	I351N	probably damaging	Het

Other mutations in Senp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Senp3	APN	11	69,564,919 (GRCm39)	missense	possibly damaging	0.50
IGL02227:Senp3	APN	11	69,565,356 (GRCm39)	missense	possibly damaging	0.95
IGL02942:Senp3	APN	11	69,568,815 (GRCm39)	missense	probably benign	0.02
IGL02996:Senp3	APN	11	69,565,086 (GRCm39)	missense	probably damaging	1.00
R0784:Senp3	UTSW	11	69,571,274 (GRCm39)	missense	probably damaging	0.99
R4619:Senp3	UTSW	11	69,567,944 (GRCm39)	missense	probably benign	0.00
R4620:Senp3	UTSW	11	69,567,944 (GRCm39)	missense	probably benign	0.00
R4737:Senp3	UTSW	11	69,569,655 (GRCm39)	nonsense	probably null
R4777:Senp3	UTSW	11	69,569,063 (GRCm39)	missense	probably damaging	1.00
R4824:Senp3	UTSW	11	69,568,821 (GRCm39)	missense	probably benign	0.16
R5513:Senp3	UTSW	11	69,567,965 (GRCm39)	missense	probably benign
R5870:Senp3	UTSW	11	69,569,048 (GRCm39)	splice site	probably null
R7206:Senp3	UTSW	11	69,569,557 (GRCm39)	missense	probably benign	0.08
R7735:Senp3	UTSW	11	69,569,087 (GRCm39)	missense	probably damaging	0.99
R8724:Senp3	UTSW	11	69,564,419 (GRCm39)	missense	probably damaging	0.99
R9228:Senp3	UTSW	11	69,569,085 (GRCm39)	missense	probably damaging	0.96
R9767:Senp3	UTSW	11	69,569,013 (GRCm39)	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- AGTCCCAACTGAGGATGGAG -3'
(R):5'- TCTTGCCCACATAGCATATTGC -3'

Sequencing Primer
(F):5'- AACCAGGGTTTCTGTGCTAACAC -3'
(R):5'- GCATATTGCCAAGTATCTACAGGC -3'

Posted On

2014-12-04