Incidental Mutation 'R2867:Tigd4'
ID253315
Institutional Source Beutler Lab
Gene Symbol Tigd4
Ensembl Gene ENSMUSG00000047819
Gene Nametigger transposable element derived 4
SynonymsTigd4, C130063O11Rik
MMRRC Submission 040456-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R2867 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location84593574-84597032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84593952 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 59 (N59D)
Ref Sequence ENSEMBL: ENSMUSP00000052320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062623] [ENSMUST00000154148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062623
AA Change: N59D

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052320
Gene: ENSMUSG00000047819
AA Change: N59D

DomainStartEndE-ValueType
Pfam:CENP-B_N 15 67 9e-14 PFAM
CENPB 81 146 5.52e-16 SMART
Pfam:DDE_1 211 375 4.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Meta Mutation Damage Score 0.4895 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 94.8%
  • 20x: 82.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss T C 1: 177,767,812 probably null Het
Arid3c T C 4: 41,725,958 D215G probably damaging Het
Birc2 A C 9: 7,834,477 M1R probably null Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Cyp7a1 T C 4: 6,272,493 E240G probably damaging Het
Epha6 T C 16: 59,960,296 probably null Het
Gm42542 T C 6: 68,895,650 probably null Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Kif20b A G 19: 34,940,128 E631G probably damaging Het
Lctl T C 9: 64,137,868 S550P probably benign Het
Lrrc6 A T 15: 66,438,408 L337* probably null Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
N4bp1 T C 8: 86,861,405 N302D probably benign Het
Pcdh7 A T 5: 57,721,894 K930N probably damaging Het
Pramef25 T A 4: 143,948,886 I457L probably benign Het
Proca1 A T 11: 78,204,980 N146I probably damaging Het
Ryr2 A T 13: 11,761,349 W1101R probably damaging Het
Slc35d3 T C 10: 19,849,463 T216A probably benign Het
Thnsl2 C A 6: 71,131,961 D289Y probably damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Tradd G T 8: 105,259,513 F182L probably benign Het
Trav17 A T 14: 53,806,926 Y50F probably benign Het
Usp37 A T 1: 74,450,532 D808E probably damaging Het
Usp42 G A 5: 143,715,464 P935S possibly damaging Het
Vmn2r23 A G 6: 123,713,164 D333G possibly damaging Het
Zfpm2 C T 15: 41,099,389 A149V probably benign Het
Other mutations in Tigd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01791:Tigd4 APN 3 84594745 missense probably damaging 1.00
R0080:Tigd4 UTSW 3 84594145 missense probably benign 0.19
R0320:Tigd4 UTSW 3 84595174 missense probably benign
R0347:Tigd4 UTSW 3 84593860 missense probably damaging 1.00
R1875:Tigd4 UTSW 3 84595087 missense probably benign 0.00
R1876:Tigd4 UTSW 3 84593935 nonsense probably null
R2142:Tigd4 UTSW 3 84594363 missense possibly damaging 0.95
R2258:Tigd4 UTSW 3 84594293 missense probably benign 0.00
R2519:Tigd4 UTSW 3 84593914 missense probably damaging 1.00
R2866:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R2867:Tigd4 UTSW 3 84593952 missense possibly damaging 0.48
R3974:Tigd4 UTSW 3 84595278 missense possibly damaging 0.82
R4094:Tigd4 UTSW 3 84594640 missense probably damaging 1.00
R4967:Tigd4 UTSW 3 84595153 missense probably benign 0.03
R5155:Tigd4 UTSW 3 84594663 missense possibly damaging 0.96
R5878:Tigd4 UTSW 3 84594442 missense probably benign 0.09
R6174:Tigd4 UTSW 3 84595267 missense probably benign 0.02
R6960:Tigd4 UTSW 3 84594116 missense probably damaging 1.00
R7414:Tigd4 UTSW 3 84593821 missense probably benign 0.37
R7445:Tigd4 UTSW 3 84595164 missense probably benign 0.01
R7696:Tigd4 UTSW 3 84594917 missense possibly damaging 0.89
R7810:Tigd4 UTSW 3 84595003 missense possibly damaging 0.49
X0023:Tigd4 UTSW 3 84593857 missense probably damaging 1.00
X0064:Tigd4 UTSW 3 84594478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACACCAGGAGCTCAGAGC -3'
(R):5'- GGCAAAATCATTAGCTTTTAGACGC -3'

Sequencing Primer
(F):5'- CACAAGCCGCATCTGAGATGG -3'
(R):5'- TTTTAGACGCAACATCGGGC -3'
Posted On2014-12-04