Incidental Mutation 'R2475:Mavs'
ID253326
Institutional Source Beutler Lab
Gene Symbol Mavs
Ensembl Gene ENSMUSG00000037523
Gene Namemitochondrial antiviral signaling protein
SynonymsIPS-1, D430028G21Rik
MMRRC Submission 040406-MU
Accession Numbers

MGI: 2444773

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2475 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131234063-131248025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 131240450 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 85 (A85S)
Ref Sequence ENSEMBL: ENSMUSP00000105828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041362] [ENSMUST00000110199] [ENSMUST00000130597]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000041362
AA Change: A85S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038339
Gene: ENSMUSG00000037523
AA Change: A85S

DomainStartEndE-ValueType
PDB:3J6C|A 1 93 6e-41 PDB
PDB:4GHU|B 138 158 6e-6 PDB
low complexity region 244 265 N/A INTRINSIC
low complexity region 276 296 N/A INTRINSIC
transmembrane domain 479 496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110199
AA Change: A85S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105828
Gene: ENSMUSG00000037523
AA Change: A85S

DomainStartEndE-ValueType
Pfam:CARD_2 4 92 1.9e-22 PFAM
PDB:4GHU|B 138 158 6e-6 PDB
low complexity region 244 265 N/A INTRINSIC
low complexity region 276 296 N/A INTRINSIC
transmembrane domain 479 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130597
SMART Domains Protein: ENSMUSP00000138401
Gene: ENSMUSG00000037523

DomainStartEndE-ValueType
PDB:3J6C|A 1 52 8e-16 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132694
Meta Mutation Damage Score 0.5539 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intermediary protein necessary in the virus-triggered beta interferon signaling pathways. It is required for activation of transcription factors which regulate expression of beta interferon and contributes to antiviral immunity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous and heterozygous mice for mutations display defective innate immunity in response to viral infections. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(5) Gene trapped(6)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,640,078 M458K probably benign Het
Atic C T 1: 71,559,269 R64C probably damaging Het
Atp7b C T 8: 21,994,776 V1307M possibly damaging Het
Bbx C A 16: 50,220,519 R707L probably damaging Het
Ccdc28b A T 4: 129,620,652 probably null Het
Gm13078 T A 4: 143,726,825 Y168N probably benign Het
Gm21136 T A 7: 38,867,834 T57S probably damaging Het
Gm5862 G A 5: 26,019,492 L160F probably damaging Het
Gpsm3 A G 17: 34,590,560 T47A possibly damaging Het
Grip1 T C 10: 119,978,496 Y311H probably benign Het
Inpp4b T A 8: 82,041,978 N705K probably benign Het
Lingo1 T A 9: 56,619,626 I560F probably benign Het
Man2b2 A G 5: 36,807,875 V958A probably benign Het
Nipbl A T 15: 8,335,006 C1305S probably benign Het
Olfr112 A G 17: 37,563,711 V200A probably benign Het
Phf19 C T 2: 34,895,795 R554Q probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Trpm8 A G 1: 88,354,449 D689G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A G 2: 76,872,750 probably benign Het
Wrnip1 G A 13: 32,806,958 R400H probably benign Het
Other mutations in Mavs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Mavs APN 2 131246716 missense probably damaging 1.00
IGL01520:Mavs APN 2 131245343 missense probably benign 0.38
IGL01909:Mavs APN 2 131245521 missense probably benign 0.43
IGL01941:Mavs APN 2 131246605 missense probably damaging 1.00
R0044:Mavs UTSW 2 131242024 missense probably damaging 1.00
R0044:Mavs UTSW 2 131242024 missense probably damaging 1.00
R0045:Mavs UTSW 2 131238831 missense probably damaging 1.00
R0751:Mavs UTSW 2 131246764 missense probably damaging 1.00
R2051:Mavs UTSW 2 131240450 missense possibly damaging 0.94
R2061:Mavs UTSW 2 131240306 splice site probably benign
R3883:Mavs UTSW 2 131245298 missense probably benign
R4152:Mavs UTSW 2 131246608 missense probably benign 0.22
R4580:Mavs UTSW 2 131240450 missense probably damaging 1.00
R4619:Mavs UTSW 2 131240450 missense probably damaging 1.00
R4779:Mavs UTSW 2 131240365 missense probably damaging 1.00
R4928:Mavs UTSW 2 131246743 missense probably benign 0.00
R6092:Mavs UTSW 2 131245598 nonsense probably null
R6211:Mavs UTSW 2 131240391 missense probably damaging 0.99
R7024:Mavs UTSW 2 131243131 missense probably benign 0.01
R7568:Mavs UTSW 2 131245475 missense probably benign 0.17
Z1176:Mavs UTSW 2 131240401 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGAAAAGCCTAGGCCACCTG -3'
(R):5'- GCTAAGTGCAGCCACACATG -3'

Sequencing Primer
(F):5'- CCACCTGGCCTAAGGAGG -3'
(R):5'- AGTGGCTCAGCTGGATCTAAATC -3'
Posted On2014-12-04