Incidental Mutation 'R2475:Ccdc28b'
ID253328
Institutional Source Beutler Lab
Gene Symbol Ccdc28b
Ensembl Gene ENSMUSG00000028795
Gene Namecoiled coil domain containing 28B
Synonyms
MMRRC Submission 040406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R2475 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129619274-129623947 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 129620652 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030586] [ENSMUST00000046675] [ENSMUST00000106035] [ENSMUST00000121442] [ENSMUST00000137090] [ENSMUST00000150357] [ENSMUST00000151838] [ENSMUST00000174073]
Predicted Effect probably benign
Transcript: ENSMUST00000030586
SMART Domains Protein: ENSMUSP00000030586
Gene: ENSMUSG00000028795

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 185 4.3e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000046675
SMART Domains Protein: ENSMUSP00000040584
Gene: ENSMUSG00000040795

DomainStartEndE-ValueType
IQ 5 27 6.6e-2 SMART
low complexity region 150 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106035
AA Change: W186R

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101652
Gene: ENSMUSG00000028795
AA Change: W186R

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 86 178 2.2e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121442
SMART Domains Protein: ENSMUSP00000113036
Gene: ENSMUSG00000040795

DomainStartEndE-ValueType
IQ 5 27 6.6e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131559
Predicted Effect probably benign
Transcript: ENSMUST00000137090
SMART Domains Protein: ENSMUSP00000117568
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146378
Predicted Effect probably benign
Transcript: ENSMUST00000150357
SMART Domains Protein: ENSMUSP00000118241
Gene: ENSMUSG00000028795

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 104 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151838
SMART Domains Protein: ENSMUSP00000122229
Gene: ENSMUSG00000028795

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
Pfam:DUF4061 85 120 1.1e-13 PFAM
low complexity region 132 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152708
Predicted Effect probably benign
Transcript: ENSMUST00000174073
SMART Domains Protein: ENSMUSP00000133325
Gene: ENSMUSG00000028797

DomainStartEndE-ValueType
Pfam:UPF0546 11 62 1.1e-12 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene localizes to centrosomes and basal bodies. The protein colocalizes with several proteins associated with Bardet-Biedl syndrome (BBS) and participates in the regulation of cilia development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,640,078 M458K probably benign Het
Atic C T 1: 71,559,269 R64C probably damaging Het
Atp7b C T 8: 21,994,776 V1307M possibly damaging Het
Bbx C A 16: 50,220,519 R707L probably damaging Het
Gm13078 T A 4: 143,726,825 Y168N probably benign Het
Gm21136 T A 7: 38,867,834 T57S probably damaging Het
Gm5862 G A 5: 26,019,492 L160F probably damaging Het
Gpsm3 A G 17: 34,590,560 T47A possibly damaging Het
Grip1 T C 10: 119,978,496 Y311H probably benign Het
Inpp4b T A 8: 82,041,978 N705K probably benign Het
Lingo1 T A 9: 56,619,626 I560F probably benign Het
Man2b2 A G 5: 36,807,875 V958A probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Nipbl A T 15: 8,335,006 C1305S probably benign Het
Olfr112 A G 17: 37,563,711 V200A probably benign Het
Phf19 C T 2: 34,895,795 R554Q probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Trpm8 A G 1: 88,354,449 D689G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A G 2: 76,872,750 probably benign Het
Wrnip1 G A 13: 32,806,958 R400H probably benign Het
Other mutations in Ccdc28b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4362001:Ccdc28b UTSW 4 129621025 missense probably benign 0.00
R0722:Ccdc28b UTSW 4 129621152 critical splice acceptor site probably null
R1172:Ccdc28b UTSW 4 129620889 intron probably benign
R1440:Ccdc28b UTSW 4 129620615 missense probably benign
R1842:Ccdc28b UTSW 4 129621013 missense probably damaging 1.00
R5396:Ccdc28b UTSW 4 129619445 missense probably damaging 0.99
R6523:Ccdc28b UTSW 4 129620987 missense probably damaging 1.00
R7125:Ccdc28b UTSW 4 129621092 missense probably benign 0.20
R7445:Ccdc28b UTSW 4 129622607 missense probably benign 0.05
Z1176:Ccdc28b UTSW 4 129621104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAATCCCTAAGGCCCCTTG -3'
(R):5'- GAAGTTGGCCAGACTGCACTTC -3'

Sequencing Primer
(F):5'- GGAATTGCTAAGATCTTCCAGCTGTC -3'
(R):5'- AGACTGCACTTCAGCCTGGATG -3'
Posted On2014-12-04