Incidental Mutation 'R2475:Gm13078'
ID253330
Institutional Source Beutler Lab
Gene Symbol Gm13078
Ensembl Gene ENSMUSG00000046435
Gene Namepredicted gene 13078
Synonyms
MMRRC Submission 040406-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R2475 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143719455-143729158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143726825 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 168 (Y168N)
Ref Sequence ENSEMBL: ENSMUSP00000077761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078695]
Predicted Effect probably benign
Transcript: ENSMUST00000078695
AA Change: Y168N

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077761
Gene: ENSMUSG00000046435
AA Change: Y168N

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 412 4e-12 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,640,078 M458K probably benign Het
Atic C T 1: 71,559,269 R64C probably damaging Het
Atp7b C T 8: 21,994,776 V1307M possibly damaging Het
Bbx C A 16: 50,220,519 R707L probably damaging Het
Ccdc28b A T 4: 129,620,652 probably null Het
Gm21136 T A 7: 38,867,834 T57S probably damaging Het
Gm5862 G A 5: 26,019,492 L160F probably damaging Het
Gpsm3 A G 17: 34,590,560 T47A possibly damaging Het
Grip1 T C 10: 119,978,496 Y311H probably benign Het
Inpp4b T A 8: 82,041,978 N705K probably benign Het
Lingo1 T A 9: 56,619,626 I560F probably benign Het
Man2b2 A G 5: 36,807,875 V958A probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Nipbl A T 15: 8,335,006 C1305S probably benign Het
Olfr112 A G 17: 37,563,711 V200A probably benign Het
Phf19 C T 2: 34,895,795 R554Q probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Trpm8 A G 1: 88,354,449 D689G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A G 2: 76,872,750 probably benign Het
Wrnip1 G A 13: 32,806,958 R400H probably benign Het
Other mutations in Gm13078
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Gm13078 APN 4 143727015 missense probably damaging 1.00
IGL01122:Gm13078 APN 4 143728401 missense probably benign 0.13
IGL02314:Gm13078 APN 4 143728442 missense probably benign 0.00
IGL03089:Gm13078 APN 4 143726133 missense probably benign 0.43
IGL03338:Gm13078 APN 4 143726742 missense probably benign 0.01
R0233:Gm13078 UTSW 4 143726063 missense possibly damaging 0.71
R0233:Gm13078 UTSW 4 143726063 missense possibly damaging 0.71
R0349:Gm13078 UTSW 4 143727059 missense probably benign 0.00
R0681:Gm13078 UTSW 4 143728052 missense probably benign
R0963:Gm13078 UTSW 4 143727108 missense possibly damaging 0.50
R1114:Gm13078 UTSW 4 143726855 missense probably benign 0.01
R2070:Gm13078 UTSW 4 143726902 nonsense probably null
R3824:Gm13078 UTSW 4 143726685 missense probably benign 0.00
R4050:Gm13078 UTSW 4 143727122 missense probably benign 0.01
R4125:Gm13078 UTSW 4 143726280 nonsense probably null
R4273:Gm13078 UTSW 4 143726846 nonsense probably null
R4280:Gm13078 UTSW 4 143726022 missense possibly damaging 0.94
R4921:Gm13078 UTSW 4 143728326 missense possibly damaging 0.95
R5223:Gm13078 UTSW 4 143728021 missense probably benign 0.00
R7256:Gm13078 UTSW 4 143726279 missense probably benign 0.23
R7640:Gm13078 UTSW 4 143726706 missense probably benign 0.00
R7666:Gm13078 UTSW 4 143728515 missense probably benign 0.00
R7683:Gm13078 UTSW 4 143726714 nonsense probably null
Z1088:Gm13078 UTSW 4 143727033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGACTTCTGGGATGGTTG -3'
(R):5'- AGGCCTATCCCAAGATATGCAG -3'

Sequencing Primer
(F):5'- TGGGCTGGATTACTTCATGAAG -3'
(R):5'- GGCCTATCCCAAGATATGCAGATTTC -3'
Posted On2014-12-04