Incidental Mutation 'R2475:Gm5862'
ID253332
Institutional Source Beutler Lab
Gene Symbol Gm5862
Ensembl Gene ENSMUSG00000067700
Gene Namepredicted gene 5862
Synonyms
MMRRC Submission 040406-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R2475 (G1)
Quality Score144
Status Validated
Chromosome5
Chromosomal Location26017278-26022916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26019492 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 160 (L160F)
Ref Sequence ENSEMBL: ENSMUSP00000072133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072286]
Predicted Effect probably damaging
Transcript: ENSMUST00000072286
AA Change: L160F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072133
Gene: ENSMUSG00000067700
AA Change: L160F

DomainStartEndE-ValueType
Pfam:Takusan 50 134 1.6e-25 PFAM
low complexity region 154 168 N/A INTRINSIC
low complexity region 235 259 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,640,078 M458K probably benign Het
Atic C T 1: 71,559,269 R64C probably damaging Het
Atp7b C T 8: 21,994,776 V1307M possibly damaging Het
Bbx C A 16: 50,220,519 R707L probably damaging Het
Ccdc28b A T 4: 129,620,652 probably null Het
Gm13078 T A 4: 143,726,825 Y168N probably benign Het
Gm21136 T A 7: 38,867,834 T57S probably damaging Het
Gpsm3 A G 17: 34,590,560 T47A possibly damaging Het
Grip1 T C 10: 119,978,496 Y311H probably benign Het
Inpp4b T A 8: 82,041,978 N705K probably benign Het
Lingo1 T A 9: 56,619,626 I560F probably benign Het
Man2b2 A G 5: 36,807,875 V958A probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Nipbl A T 15: 8,335,006 C1305S probably benign Het
Olfr112 A G 17: 37,563,711 V200A probably benign Het
Phf19 C T 2: 34,895,795 R554Q probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Trpm8 A G 1: 88,354,449 D689G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn A G 2: 76,872,750 probably benign Het
Wrnip1 G A 13: 32,806,958 R400H probably benign Het
Other mutations in Gm5862
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Gm5862 APN 5 26019516 missense probably benign
IGL01863:Gm5862 APN 5 26022771 missense probably benign
IGL01868:Gm5862 APN 5 26022771 missense probably benign
IGL01873:Gm5862 APN 5 26022771 missense probably benign
IGL01881:Gm5862 APN 5 26022771 missense probably benign
IGL01902:Gm5862 APN 5 26022771 missense probably benign
IGL01905:Gm5862 APN 5 26022771 missense probably benign
IGL01909:Gm5862 APN 5 26022771 missense probably benign
IGL01917:Gm5862 APN 5 26022771 missense probably benign
IGL01924:Gm5862 APN 5 26022771 missense probably benign
IGL01927:Gm5862 APN 5 26022771 missense probably benign
IGL01951:Gm5862 APN 5 26022771 missense probably benign
IGL03374:Gm5862 APN 5 26019512 missense probably damaging 0.98
R3828:Gm5862 UTSW 5 26019347 missense probably benign 0.27
R4591:Gm5862 UTSW 5 26019488 missense possibly damaging 0.95
R6916:Gm5862 UTSW 5 26019348 missense probably benign
Z1176:Gm5862 UTSW 5 26018487 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGACTGAATTGTTTGTCCCTACCTG -3'
(R):5'- TTGGTGTTTGGACTACAGCC -3'

Sequencing Primer
(F):5'- ACCTGATGTTCTTGAGTCTCCAGG -3'
(R):5'- GGTGTTTGGACTACAGCCAAAATTTC -3'
Posted On2014-12-04