Mutagenetix > Incidental Mutation

Incidental Mutation 'R2475:Atp7b'

253342

Institutional Source

Beutler Lab

Gene Symbol

Atp7b

Ensembl Gene

ENSMUSG00000006567

Gene Name

ATPase, Cu++ transporting, beta polypeptide

Synonyms

Atp7a, WND, Wilson protein

MMRRC Submission

040406-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.602) question?

Stock #

R2475 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22482801-22550321 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 22484792 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1307 (V1307M)

Ref Sequence

ENSEMBL: ENSMUSP00000106366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]

AlphaFold

Q64446

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006742
AA Change: V1422M

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: V1422M

Domain	Start	End	E-Value	Type
Pfam:HMA	71	132	8.8e-14	PFAM
Pfam:HMA	156	217	6.6e-13	PFAM
Pfam:HMA	271	329	7.4e-13	PFAM
Pfam:HMA	364	425	1.1e-10	PFAM
Pfam:HMA	493	554	2.3e-14	PFAM
Pfam:HMA	569	630	3.1e-15	PFAM
transmembrane domain	656	675	N/A	INTRINSIC
Pfam:E1-E2_ATPase	770	1018	3.3e-60	PFAM
Pfam:Hydrolase	1023	1276	1.3e-67	PFAM
Pfam:HAD	1026	1273	4.6e-10	PFAM
Pfam:Hydrolase_3	1243	1308	5.1e-7	PFAM
transmembrane domain	1322	1344	N/A	INTRINSIC
low complexity region	1353	1370	N/A	INTRINSIC
low complexity region	1418	1437	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110738
AA Change: V1307M

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: V1307M

Domain	Start	End	E-Value	Type
Pfam:HMA	59	120	1.2e-13	PFAM
Pfam:HMA	144	205	9.7e-12	PFAM
PDB:2AW0\|A	259	314	6e-6	PDB
Pfam:HMA	378	439	1.6e-13	PFAM
Pfam:HMA	454	515	1.5e-15	PFAM
transmembrane domain	541	560	N/A	INTRINSIC
Pfam:E1-E2_ATPase	656	904	4.6e-50	PFAM
Pfam:Hydrolase	908	1161	6.6e-76	PFAM
Pfam:HAD	911	1158	1.5e-15	PFAM
Pfam:Hydrolase_3	1128	1193	8.5e-7	PFAM
transmembrane domain	1207	1229	N/A	INTRINSIC
low complexity region	1238	1255	N/A	INTRINSIC
low complexity region	1303	1322	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1a1	T	A	19: 20,617,442 (GRCm39)	M458K	probably benign	Het
Atic	C	T	1: 71,598,428 (GRCm39)	R64C	probably damaging	Het
Bbx	C	A	16: 50,040,882 (GRCm39)	R707L	probably damaging	Het
Ccdc28b	A	T	4: 129,514,445 (GRCm39)		probably null	Het
Gm21136	T	A	7: 38,567,258 (GRCm39)	T57S	probably damaging	Het
Gm5862	G	A	5: 26,224,490 (GRCm39)	L160F	probably damaging	Het
Gpsm3	A	G	17: 34,809,534 (GRCm39)	T47A	possibly damaging	Het
Grip1	T	C	10: 119,814,401 (GRCm39)	Y311H	probably benign	Het
Inpp4b	T	A	8: 82,768,607 (GRCm39)	N705K	probably benign	Het
Lingo1	T	A	9: 56,526,910 (GRCm39)	I560F	probably benign	Het
Man2b2	A	G	5: 36,965,219 (GRCm39)	V958A	probably benign	Het
Mavs	G	T	2: 131,082,370 (GRCm39)	A85S	probably damaging	Het
Nipbl	A	T	15: 8,364,490 (GRCm39)	C1305S	probably benign	Het
Or14j9	A	G	17: 37,874,602 (GRCm39)	V200A	probably benign	Het
Phf19	C	T	2: 34,785,807 (GRCm39)	R554Q	probably benign	Het
Pramel24	T	A	4: 143,453,395 (GRCm39)	Y168N	probably benign	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Secisbp2l	C	T	2: 125,582,657 (GRCm39)	G933D	possibly damaging	Het
Trpm8	A	G	1: 88,282,171 (GRCm39)	D689G	probably damaging	Het
Ttn	A	T	2: 76,641,587 (GRCm39)	L5176Q	possibly damaging	Het
Ttn	A	G	2: 76,703,094 (GRCm39)		probably benign	Het
Wrnip1	G	A	13: 32,990,941 (GRCm39)	R400H	probably benign	Het

Other mutations in Atp7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Atp7b	APN	8	22,501,114 (GRCm39)	missense	possibly damaging	0.91
IGL00981:Atp7b	APN	8	22,517,543 (GRCm39)	splice site	probably null
IGL01600:Atp7b	APN	8	22,517,541 (GRCm39)	splice site	probably null
IGL01713:Atp7b	APN	8	22,518,589 (GRCm39)	missense	probably damaging	1.00
IGL01778:Atp7b	APN	8	22,484,844 (GRCm39)	missense	probably benign	0.42
IGL01926:Atp7b	APN	8	22,501,797 (GRCm39)	missense	probably damaging	0.98
IGL02312:Atp7b	APN	8	22,484,786 (GRCm39)	missense	probably damaging	0.99
IGL02562:Atp7b	APN	8	22,518,101 (GRCm39)	missense	probably benign
IGL02573:Atp7b	APN	8	22,512,486 (GRCm39)	missense	probably benign	0.00
IGL02603:Atp7b	APN	8	22,484,792 (GRCm39)	missense	possibly damaging	0.88
IGL02622:Atp7b	APN	8	22,518,454 (GRCm39)	missense	possibly damaging	0.69
IGL02721:Atp7b	APN	8	22,512,493 (GRCm39)	missense	probably benign	0.00
IGL03145:Atp7b	APN	8	22,508,159 (GRCm39)	missense	probably damaging	1.00
daffodil	UTSW	8	22,488,282 (GRCm39)	missense	probably damaging	1.00
menace	UTSW	8	22,512,381 (GRCm39)	missense	probably damaging	0.97
PIT4131001:Atp7b	UTSW	8	22,484,672 (GRCm39)	missense	probably damaging	1.00
R0023:Atp7b	UTSW	8	22,501,089 (GRCm39)	missense	probably damaging	1.00
R0046:Atp7b	UTSW	8	22,550,011 (GRCm39)	missense	probably benign	0.00
R0128:Atp7b	UTSW	8	22,518,188 (GRCm39)	missense	possibly damaging	0.47
R0130:Atp7b	UTSW	8	22,518,188 (GRCm39)	missense	possibly damaging	0.47
R0325:Atp7b	UTSW	8	22,518,467 (GRCm39)	missense	probably benign	0.22
R0412:Atp7b	UTSW	8	22,485,675 (GRCm39)	splice site	probably null
R0856:Atp7b	UTSW	8	22,487,647 (GRCm39)	missense	probably damaging	1.00
R0906:Atp7b	UTSW	8	22,517,842 (GRCm39)	missense	probably benign
R0989:Atp7b	UTSW	8	22,518,710 (GRCm39)	missense	possibly damaging	0.51
R1377:Atp7b	UTSW	8	22,501,801 (GRCm39)	missense	probably benign	0.17
R1517:Atp7b	UTSW	8	22,487,374 (GRCm39)	missense	probably damaging	1.00
R1521:Atp7b	UTSW	8	22,517,689 (GRCm39)	missense	probably damaging	0.96
R1529:Atp7b	UTSW	8	22,518,740 (GRCm39)	missense	possibly damaging	0.87
R1691:Atp7b	UTSW	8	22,501,039 (GRCm39)	missense	possibly damaging	0.90
R1743:Atp7b	UTSW	8	22,496,403 (GRCm39)	missense	probably damaging	1.00
R1815:Atp7b	UTSW	8	22,501,667 (GRCm39)	missense	possibly damaging	0.80
R2008:Atp7b	UTSW	8	22,517,996 (GRCm39)	missense	probably damaging	1.00
R2133:Atp7b	UTSW	8	22,501,093 (GRCm39)	missense	probably damaging	1.00
R2155:Atp7b	UTSW	8	22,503,600 (GRCm39)	missense	possibly damaging	0.69
R2182:Atp7b	UTSW	8	22,504,563 (GRCm39)	missense	probably damaging	0.99
R2256:Atp7b	UTSW	8	22,488,282 (GRCm39)	missense	probably damaging	1.00
R2257:Atp7b	UTSW	8	22,488,282 (GRCm39)	missense	probably damaging	1.00
R2274:Atp7b	UTSW	8	22,510,848 (GRCm39)	missense	probably benign	0.20
R2906:Atp7b	UTSW	8	22,501,570 (GRCm39)	missense	probably damaging	1.00
R2907:Atp7b	UTSW	8	22,501,570 (GRCm39)	missense	probably damaging	1.00
R3421:Atp7b	UTSW	8	22,518,686 (GRCm39)	missense	probably damaging	1.00
R3422:Atp7b	UTSW	8	22,518,686 (GRCm39)	missense	probably damaging	1.00
R3688:Atp7b	UTSW	8	22,494,246 (GRCm39)	missense	probably damaging	1.00
R3945:Atp7b	UTSW	8	22,510,880 (GRCm39)	missense	probably benign	0.02
R4235:Atp7b	UTSW	8	22,501,039 (GRCm39)	missense	possibly damaging	0.90
R4700:Atp7b	UTSW	8	22,490,137 (GRCm39)	missense	probably benign	0.00
R4701:Atp7b	UTSW	8	22,490,137 (GRCm39)	missense	probably benign	0.00
R4877:Atp7b	UTSW	8	22,518,617 (GRCm39)	missense	probably damaging	0.98
R4962:Atp7b	UTSW	8	22,510,901 (GRCm39)	missense	probably damaging	1.00
R5009:Atp7b	UTSW	8	22,517,714 (GRCm39)	missense	possibly damaging	0.88
R5016:Atp7b	UTSW	8	22,505,885 (GRCm39)	splice site	probably null
R5038:Atp7b	UTSW	8	22,518,472 (GRCm39)	missense	possibly damaging	0.67
R5438:Atp7b	UTSW	8	22,504,570 (GRCm39)	missense	probably benign
R5467:Atp7b	UTSW	8	22,501,570 (GRCm39)	missense	probably damaging	1.00
R5468:Atp7b	UTSW	8	22,549,986 (GRCm39)	critical splice donor site	probably null
R5512:Atp7b	UTSW	8	22,502,755 (GRCm39)	missense	probably benign	0.20
R5563:Atp7b	UTSW	8	22,518,730 (GRCm39)	missense	possibly damaging	0.82
R5751:Atp7b	UTSW	8	22,508,144 (GRCm39)	missense	probably damaging	1.00
R5773:Atp7b	UTSW	8	22,517,879 (GRCm39)	missense	probably benign
R5941:Atp7b	UTSW	8	22,487,512 (GRCm39)	missense	probably damaging	0.98
R6227:Atp7b	UTSW	8	22,510,841 (GRCm39)	missense	possibly damaging	0.63
R6265:Atp7b	UTSW	8	22,505,943 (GRCm39)	nonsense	probably null
R6290:Atp7b	UTSW	8	22,510,836 (GRCm39)	missense	probably damaging	1.00
R6368:Atp7b	UTSW	8	22,510,771 (GRCm39)	splice site	probably null
R6647:Atp7b	UTSW	8	22,518,494 (GRCm39)	missense	probably damaging	1.00
R6788:Atp7b	UTSW	8	22,494,391 (GRCm39)	missense	probably benign	0.37
R6830:Atp7b	UTSW	8	22,512,381 (GRCm39)	missense	probably damaging	0.97
R6886:Atp7b	UTSW	8	22,518,706 (GRCm39)	missense	probably benign	0.01
R6928:Atp7b	UTSW	8	22,484,828 (GRCm39)	missense	probably benign
R6965:Atp7b	UTSW	8	22,518,101 (GRCm39)	missense	probably benign
R7203:Atp7b	UTSW	8	22,487,351 (GRCm39)	missense	probably damaging	1.00
R7222:Atp7b	UTSW	8	22,512,394 (GRCm39)	nonsense	probably null
R7344:Atp7b	UTSW	8	22,487,515 (GRCm39)	missense	probably damaging	1.00
R7384:Atp7b	UTSW	8	22,512,331 (GRCm39)	missense	probably benign	0.01
R7449:Atp7b	UTSW	8	22,501,865 (GRCm39)	missense	probably damaging	0.98
R7451:Atp7b	UTSW	8	22,504,700 (GRCm39)	nonsense	probably null
R7607:Atp7b	UTSW	8	22,501,522 (GRCm39)	missense	probably damaging	1.00
R8140:Atp7b	UTSW	8	22,518,576 (GRCm39)	missense	probably damaging	1.00
R8160:Atp7b	UTSW	8	22,487,575 (GRCm39)	missense	probably damaging	0.98
R8349:Atp7b	UTSW	8	22,503,556 (GRCm39)	missense	probably damaging	1.00
R8421:Atp7b	UTSW	8	22,518,487 (GRCm39)	missense	probably benign	0.01
R8449:Atp7b	UTSW	8	22,503,556 (GRCm39)	missense	probably damaging	1.00
R8749:Atp7b	UTSW	8	22,518,334 (GRCm39)	missense	probably damaging	0.96
R8989:Atp7b	UTSW	8	22,510,911 (GRCm39)	missense	probably benign	0.06
R9210:Atp7b	UTSW	8	22,487,406 (GRCm39)	missense	probably damaging	1.00
R9353:Atp7b	UTSW	8	22,517,890 (GRCm39)	missense	possibly damaging	0.78
R9462:Atp7b	UTSW	8	22,490,160 (GRCm39)	missense	probably damaging	0.99
R9485:Atp7b	UTSW	8	22,502,778 (GRCm39)	missense	probably damaging	0.99
Z1176:Atp7b	UTSW	8	22,518,730 (GRCm39)	missense	probably benign	0.07
Z1177:Atp7b	UTSW	8	22,484,893 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCCACAGTGGCTTGTTAAGG -3'
(R):5'- GGGCCTTATGTCCAGAGTGATTC -3'

Sequencing Primer
(F):5'- TGGCTCCACCACCATGAG -3'
(R):5'- TCCAGAGTGATTCGAGTATTCTC -3'

Posted On

2014-12-04