Incidental Mutation 'R2512:Dcaf8'
ID253369
Institutional Source Beutler Lab
Gene Symbol Dcaf8
Ensembl Gene ENSMUSG00000026554
Gene NameDDB1 and CUL4 associated factor 8
SynonymsD1Dau35e, Wdr42a, D1Ucla4, H326
MMRRC Submission 040418-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R2512 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172148084-172197005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 172189035 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 463 (I463S)
Ref Sequence ENSEMBL: ENSMUSP00000141732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074144] [ENSMUST00000191689] [ENSMUST00000192704] [ENSMUST00000193638]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074144
AA Change: I463S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073778
Gene: ENSMUSG00000026554
AA Change: I463S

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191689
AA Change: I463S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141731
Gene: ENSMUSG00000026554
AA Change: I463S

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000191891
AA Change: I59S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192031
Predicted Effect possibly damaging
Transcript: ENSMUST00000192704
AA Change: I463S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141732
Gene: ENSMUSG00000026554
AA Change: I463S

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
WD40 369 409 1.43e0 SMART
WD40 415 457 2.58e-1 SMART
WD40 460 500 5.91e-2 SMART
low complexity region 544 556 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193638
SMART Domains Protein: ENSMUSP00000141836
Gene: ENSMUSG00000026554

DomainStartEndE-ValueType
WD40 176 215 3.42e-7 SMART
WD40 218 260 2e-1 SMART
WD40 264 306 1.71e1 SMART
WD40 314 354 5.73e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195011
Predicted Effect probably benign
Transcript: ENSMUST00000195345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195394
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,726 T60A probably benign Het
2700049A03Rik A G 12: 71,173,171 T831A possibly damaging Het
Actg2 T A 6: 83,526,847 I72F probably damaging Het
Add1 A G 5: 34,616,686 T80A probably benign Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Aplp2 C T 9: 31,167,677 R325H probably damaging Het
Aptx G A 4: 40,694,917 P140S probably benign Het
C87499 T G 4: 88,628,958 M246L probably damaging Het
Carm1 A G 9: 21,575,412 probably null Het
Carmil2 A T 8: 105,697,393 I1293F probably benign Het
Cdh8 T C 8: 99,400,863 T39A probably benign Het
Col15a1 T A 4: 47,245,868 N206K possibly damaging Het
Copg2 C T 6: 30,896,656 probably null Het
Ctr9 T G 7: 111,046,871 I690S probably damaging Het
Dcp1b G T 6: 119,206,512 A187S possibly damaging Het
Ddo T A 10: 40,632,939 D58E possibly damaging Het
Dkkl1 G T 7: 45,207,733 R137S probably damaging Het
Dxo A G 17: 34,837,742 N115S probably benign Het
Ep400 A T 5: 110,708,915 probably benign Het
F11 A G 8: 45,261,061 V7A probably benign Het
Fermt1 G T 2: 132,939,518 probably null Het
Fign A T 2: 63,979,799 F376I probably benign Het
Flg2 G T 3: 93,201,775 G370V probably damaging Het
Fndc3a A T 14: 72,556,275 D953E probably benign Het
Fsip2 A T 2: 82,978,167 H1610L probably benign Het
Gfra3 T C 18: 34,704,511 N145D probably benign Het
Inpp4b G T 8: 82,010,550 W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lgi2 A G 5: 52,537,965 *543R probably null Het
Lyn A G 4: 3,745,542 T114A probably benign Het
Lynx1 A G 15: 74,751,320 Y88H probably damaging Het
Map4 C A 9: 110,034,702 P332T possibly damaging Het
Mapk8ip3 A T 17: 24,914,703 C250* probably null Het
Metap1d A G 2: 71,522,610 H261R probably damaging Het
Mfrp T C 9: 44,102,538 V115A probably benign Het
Mtbp A G 15: 55,577,536 Y373C probably damaging Het
Mtor C A 4: 148,530,491 R1628S possibly damaging Het
Muc5b A G 7: 141,859,076 N1920D unknown Het
Myo1d T A 11: 80,779,717 M26L probably benign Het
Neb A C 2: 52,210,831 D643E probably damaging Het
Nme1 A G 11: 93,960,687 F108L possibly damaging Het
Olfr458 A G 6: 42,460,273 S249P probably damaging Het
Olfr893 G T 9: 38,209,374 C54F probably damaging Het
Pan2 T A 10: 128,304,457 D82E probably damaging Het
Pclo A G 5: 14,712,598 D3695G unknown Het
Pcnx4 A T 12: 72,556,799 probably null Het
Plg A G 17: 12,403,229 T479A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptgis T C 2: 167,207,276 D372G probably damaging Het
Ranbp3l A G 15: 8,968,465 T14A probably benign Het
Rcc1l A T 5: 134,166,669 V230D probably damaging Het
Reln T C 5: 21,979,690 D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr1 G A 7: 29,103,542 L696F possibly damaging Het
Sacs T A 14: 61,203,080 D858E probably benign Het
Sec16a C T 2: 26,439,025 V993I probably benign Het
Skint5 T A 4: 113,630,419 I901F unknown Het
Slc17a3 A T 13: 23,846,247 I114F probably benign Het
Slc17a7 T A 7: 45,168,864 L71Q probably damaging Het
Slc43a2 T C 11: 75,570,577 S452P probably damaging Het
Smarca4 A G 9: 21,635,698 N173S possibly damaging Het
Tbc1d21 T C 9: 58,362,912 Y161C probably damaging Het
Tpsab1 C A 17: 25,345,107 C94F probably damaging Het
Ubr5 G A 15: 38,002,319 P1496L probably damaging Het
Unc80 G T 1: 66,671,608 A2679S possibly damaging Het
Vdac1 T A 11: 52,384,077 V184E probably damaging Het
Vmn2r24 T A 6: 123,787,026 S287R probably benign Het
Vmn2r91 T C 17: 18,135,786 F572L probably benign Het
Vps13b G A 15: 35,884,555 E3125K probably benign Het
Ythdf3 A G 3: 16,204,895 N406S possibly damaging Het
Zfp708 T C 13: 67,071,187 K158E probably damaging Het
Other mutations in Dcaf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03163:Dcaf8 APN 1 172172908 missense probably damaging 1.00
FR4976:Dcaf8 UTSW 1 172172856 missense probably damaging 1.00
PIT4362001:Dcaf8 UTSW 1 172172797 missense probably damaging 0.96
R0329:Dcaf8 UTSW 1 172187411 missense probably benign 0.42
R0458:Dcaf8 UTSW 1 172174043 missense probably benign 0.00
R0729:Dcaf8 UTSW 1 172172654 missense probably benign
R0731:Dcaf8 UTSW 1 172172509 missense possibly damaging 0.66
R1389:Dcaf8 UTSW 1 172174052 missense probably benign 0.00
R1496:Dcaf8 UTSW 1 172193855 missense probably benign 0.39
R1719:Dcaf8 UTSW 1 172175495 missense probably damaging 0.96
R1856:Dcaf8 UTSW 1 172175553 missense probably damaging 1.00
R2342:Dcaf8 UTSW 1 172186361 missense possibly damaging 0.48
R4163:Dcaf8 UTSW 1 172192570 missense probably damaging 1.00
R4546:Dcaf8 UTSW 1 172179893 splice site probably benign
R4880:Dcaf8 UTSW 1 172187489 intron probably benign
R5092:Dcaf8 UTSW 1 172186909 missense probably benign 0.02
R5622:Dcaf8 UTSW 1 172186398 intron probably benign
R5734:Dcaf8 UTSW 1 172172911 missense possibly damaging 0.65
R6245:Dcaf8 UTSW 1 172165867 start codon destroyed probably benign 0.01
R7090:Dcaf8 UTSW 1 172188968 missense probably damaging 0.96
R8178:Dcaf8 UTSW 1 172186319 missense probably benign 0.22
Z1176:Dcaf8 UTSW 1 172172929 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TTGGTACTCGGCTGACTCAGTC -3'
(R):5'- ATGTTCCTTCAAAATCTCAGCACC -3'

Sequencing Primer
(F):5'- TAAATACAGGCCCAGTGC -3'
(R):5'- CTCAAGGCATAACCCCTTTAGTGTAG -3'
Posted On2014-12-04