Mutagenetix > Incidental Mutation

Incidental Mutation 'R2869:Mroh2a'

253385

Institutional Source

Beutler Lab

Gene Symbol

Mroh2a

Ensembl Gene

ENSMUSG00000079429

Gene Name

maestro heat-like repeat family member 2A

Synonyms

ENSMUSG00000044873, Heatr7b1, OTTMUSG00000020804

MMRRC Submission

040457-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R2869 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

88154713-88190011 bp(+) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

GCCC to GC at 88159979 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]

AlphaFold

D3Z750

Predicted Effect

probably null
Transcript: ENSMUST00000061013

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113130

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148474

Coding Region Coverage

1x: 99.6%
3x: 98.4%
10x: 93.9%
20x: 77.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Als2	A	G	1: 59,250,296 (GRCm39)	S483P	probably damaging	Het
Ccl27a	C	T	4: 41,769,640 (GRCm39)	R73Q	probably benign	Het
Cd6	A	G	19: 10,771,990 (GRCm39)	I307T	possibly damaging	Het
Ch25h	T	A	19: 34,452,210 (GRCm39)	H106L	probably benign	Het
Dennd2b	A	T	7: 109,156,637 (GRCm39)	Y38N	probably benign	Het
Dhx57	A	T	17: 80,558,805 (GRCm39)	D1051E	probably benign	Het
Eef2	GCCC	GCCCC	10: 81,014,601 (GRCm39)		probably null	Het
Eif4enif1	C	T	11: 3,192,586 (GRCm39)	P805S	probably damaging	Het
Fan1	A	G	7: 64,012,938 (GRCm39)	I668T	probably benign	Het
Frmpd4	A	T	X: 166,260,243 (GRCm39)	D1166E	probably benign	Het
Gbp11	C	T	5: 105,478,866 (GRCm39)	D191N	probably benign	Het
Ggt6	A	T	11: 72,328,187 (GRCm39)	N229I	probably benign	Het
Gria2	G	A	3: 80,609,799 (GRCm39)	T670I	probably damaging	Het
Gsdme	A	T	6: 50,185,157 (GRCm39)	C432*	probably null	Het
Hjurp	GT	GTT	1: 88,194,246 (GRCm39)		probably null	Het
Hmcn1	A	T	1: 150,614,467 (GRCm39)	V1313D	possibly damaging	Het
Kcnb1	A	G	2: 166,947,855 (GRCm39)	L331P	probably damaging	Het
Klf8	A	T	X: 152,165,678 (GRCm39)	E82D	probably damaging	Het
Krt13	A	G	11: 100,008,475 (GRCm39)	S421P	unknown	Het
Lactbl1	G	A	4: 136,354,097 (GRCm39)	C37Y	probably damaging	Het
Lzts2	C	A	19: 45,012,534 (GRCm39)	S321*	probably null	Het
Meikin	T	C	11: 54,264,333 (GRCm39)	V103A	possibly damaging	Het
Mki67	G	A	7: 135,309,878 (GRCm39)	P191L	probably benign	Het
Mlxip	A	G	5: 123,590,730 (GRCm39)	M878V	probably benign	Het
Mpp7	G	A	18: 7,461,678 (GRCm39)	P65L	possibly damaging	Het
Myo9b	G	A	8: 71,786,981 (GRCm39)	R721Q	probably benign	Het
Nbn	T	A	4: 15,963,810 (GRCm39)	D70E	probably damaging	Het
Nomo1	C	A	7: 45,696,361 (GRCm39)	T293N	probably damaging	Het
Notum	A	G	11: 120,551,022 (GRCm39)	V48A	probably benign	Het
Nwd2	A	T	5: 63,957,671 (GRCm39)	I334L	probably benign	Het
Or10z1	T	C	1: 174,078,092 (GRCm39)	S134G	probably benign	Het
Or4k2	T	C	14: 50,423,811 (GRCm39)	T288A	probably benign	Het
Or6c211	A	T	10: 129,505,628 (GRCm39)	C253*	probably null	Het
Ostc	T	C	3: 130,497,157 (GRCm39)	N80S	probably damaging	Het
Otud4	T	A	8: 80,387,702 (GRCm39)	N300K	possibly damaging	Het
Palmd	T	C	3: 116,717,400 (GRCm39)	R366G	possibly damaging	Het
Parp1	A	G	1: 180,401,230 (GRCm39)	D45G	probably damaging	Het
Pes1	C	A	11: 3,926,834 (GRCm39)	T372K	probably benign	Het
Plcl1	A	T	1: 55,736,309 (GRCm39)	D550V	probably benign	Het
Ppp1r7	T	A	1: 93,285,585 (GRCm39)		probably null	Het
Prdx4	A	G	X: 154,123,460 (GRCm39)	V15A	probably benign	Het
Psmb8	T	C	17: 34,419,144 (GRCm39)	I146T	probably damaging	Het
Psmd13	A	T	7: 140,466,968 (GRCm39)	T116S	probably damaging	Het
Pzp	A	T	6: 128,462,519 (GRCm39)		probably null	Het
Serinc2	A	G	4: 130,159,005 (GRCm39)	S29P	probably damaging	Het
Slc39a8	T	A	3: 135,592,554 (GRCm39)		probably null	Het
Sppl2c	C	T	11: 104,078,141 (GRCm39)	P314S	probably benign	Het
St7	C	T	6: 17,819,276 (GRCm39)	P60L	probably damaging	Het
Stx3	A	T	19: 11,766,938 (GRCm39)	V91D	probably damaging	Het
Tafa2	A	T	10: 123,540,270 (GRCm39)	H42L	possibly damaging	Het
Tnni3k	C	T	3: 154,644,387 (GRCm39)		probably null	Het
Tprg1	T	C	16: 25,231,590 (GRCm39)	W189R	probably damaging	Het
Trim32	A	G	4: 65,532,694 (GRCm39)	D417G	probably damaging	Het
Vmn2r68	A	C	7: 84,882,834 (GRCm39)	M306R	probably benign	Het
Vwa7	G	A	17: 35,240,218 (GRCm39)	M395I	probably damaging	Het
Ybx3	G	A	6: 131,347,376 (GRCm39)	A253V	probably damaging	Het
Zfp53	A	T	17: 21,728,340 (GRCm39)	E124D	probably benign	Het

Other mutations in Mroh2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Mroh2a	APN	1	88,172,692 (GRCm39)	missense	probably benign	0.03
IGL00990:Mroh2a	APN	1	88,161,842 (GRCm39)	missense	possibly damaging	0.76
IGL00990:Mroh2a	APN	1	88,158,468 (GRCm39)	missense	probably damaging	0.99
IGL03097:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R0032:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0068:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0139:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R0197:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R0242:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0322:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0374:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0387:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R0412:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
R0536:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0548:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0580:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0581:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0583:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0613:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0652:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0657:Mroh2a	UTSW	1	88,183,287 (GRCm39)	missense	probably damaging	1.00
R0659:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0659:Mroh2a	UTSW	1	88,178,064 (GRCm39)	missense	probably damaging	1.00
R0671:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0675:Mroh2a	UTSW	1	88,156,102 (GRCm39)	missense	probably damaging	0.99
R0675:Mroh2a	UTSW	1	88,178,064 (GRCm39)	missense	probably damaging	1.00
R0689:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0689:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0735:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0761:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0766:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0845:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0853:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0959:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R0960:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1004:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1013:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R1028:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R1268:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1281:Mroh2a	UTSW	1	88,183,889 (GRCm39)	frame shift	probably null
R1414:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R1439:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R1441:Mroh2a	UTSW	1	88,169,353 (GRCm39)	missense	possibly damaging	0.93
R1442:Mroh2a	UTSW	1	88,160,075 (GRCm39)	splice site	probably benign
R1442:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1465:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R1662:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R1686:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1686:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R1780:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1846:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R1899:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R1958:Mroh2a	UTSW	1	88,165,213 (GRCm39)	nonsense	probably null
R2122:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R2248:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R2306:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R2870:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R2871:Mroh2a	UTSW	1	88,183,287 (GRCm39)	missense	probably damaging	1.00
R2872:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3408:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3608:Mroh2a	UTSW	1	88,172,717 (GRCm39)	missense	probably damaging	1.00
R3730:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3937:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4022:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R4049:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4133:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4361:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4392:Mroh2a	UTSW	1	88,187,311 (GRCm39)	missense	probably damaging	1.00
R4401:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4402:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4575:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4625:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4631:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4665:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R4701:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R4701:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R4771:Mroh2a	UTSW	1	88,179,087 (GRCm39)	missense	probably damaging	1.00
R4795:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4839:Mroh2a	UTSW	1	88,165,666 (GRCm39)	missense	probably damaging	1.00
R4873:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4875:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4896:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R5007:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5031:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5062:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5301:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5367:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R5371:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5446:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R5484:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5506:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5561:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5615:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5825:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R5891:Mroh2a	UTSW	1	88,169,337 (GRCm39)	missense	possibly damaging	0.93
R5906:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5928:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R6004:Mroh2a	UTSW	1	88,176,377 (GRCm39)	missense	probably damaging	1.00
R6035:Mroh2a	UTSW	1	88,158,390 (GRCm39)	missense	probably damaging	1.00
R6064:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6074:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R6091:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6127:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R6234:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R6244:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R6464:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R6465:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6575:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6809:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
R6819:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R6854:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R6860:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R7126:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R7818:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R8350:Mroh2a	UTSW	1	88,171,805 (GRCm39)	splice site	probably null
R9414:Mroh2a	UTSW	1	88,179,096 (GRCm39)	missense	probably benign	0.26
RF024:Mroh2a	UTSW	1	88,170,207 (GRCm39)	missense	probably damaging	1.00
V5622:Mroh2a	UTSW	1	88,154,813 (GRCm39)	start gained	probably benign
V8831:Mroh2a	UTSW	1	88,183,889 (GRCm39)	frame shift	probably null
X0027:Mroh2a	UTSW	1	88,176,335 (GRCm39)	missense	possibly damaging	0.86
X0028:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0028:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0033:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,160,014 (GRCm39)	missense	probably damaging	1.00
X0034:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0039:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,183,377 (GRCm39)	missense	probably benign	0.25
X0057:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0063:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
Z1188:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
Z1190:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
Z1192:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACATATGCCCTTGAGCAGAC -3'
(R):5'- GCAAAGCAACCACTGGGATG -3'

Sequencing Primer
(F):5'- AGTTCACCCTTTTTAAACATGTGGC -3'
(R):5'- TGGGATGCAAACCAACTTCTCATTC -3'

Posted On

2014-12-04