Mutagenetix > Incidental Mutations

Incidental Mutation 'R2512:Ptgis'

253386

Institutional Source

Beutler Lab

Gene Symbol

Ptgis

Ensembl Gene

ENSMUSG00000017969

Gene Name

prostaglandin I2 (prostacyclin) synthase

Synonyms

Cyp8a1, Pgis, Pgi2

MMRRC Submission

040418-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2512 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

167191805-167240604 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 167207276 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 372 (D372G)

Ref Sequence

ENSEMBL: ENSMUSP00000085357 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018113] [ENSMUST00000088041]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018113
AA Change: D372G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000018113
Gene: ENSMUSG00000017969
AA Change: D372G

Domain	Start	End	E-Value	Type
low complexity region	4	27	N/A	INTRINSIC
Pfam:p450	31	495	8.6e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000088041
AA Change: D372G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000085357
Gene: ENSMUSG00000017969
AA Change: D372G

Domain	Start	End	E-Value	Type
low complexity region	4	27	N/A	INTRINSIC
Pfam:p450	31	496	1.9e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136271

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143645

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to prostacyclin (prostaglandin I2), a potent vasodilator and inhibitor of platelet aggregation. An imbalance of prostacyclin and its physiological antagonist thromboxane A2 contribute to the development of myocardial infarction, stroke, and atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased blood urea nitrogen and creatinine levels, thickening of the aorta with age, mildly increased blood pressure, and kidney abnormalities including cysts, fibrosis, necrosis, and renal vascular congestion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	T	C	17: 47,413,726	T60A	probably benign	Het
2700049A03Rik	A	G	12: 71,173,171	T831A	possibly damaging	Het
Actg2	T	A	6: 83,526,847	I72F	probably damaging	Het
Add1	A	G	5: 34,616,686	T80A	probably benign	Het
Alpk2	G	A	18: 65,350,520	T139M	probably damaging	Het
Aplp2	C	T	9: 31,167,677	R325H	probably damaging	Het
Aptx	G	A	4: 40,694,917	P140S	probably benign	Het
C87499	T	G	4: 88,628,958	M246L	probably damaging	Het
Carm1	A	G	9: 21,575,412		probably null	Het
Carmil2	A	T	8: 105,697,393	I1293F	probably benign	Het
Cdh8	T	C	8: 99,400,863	T39A	probably benign	Het
Col15a1	T	A	4: 47,245,868	N206K	possibly damaging	Het
Copg2	C	T	6: 30,896,656		probably null	Het
Ctr9	T	G	7: 111,046,871	I690S	probably damaging	Het
Dcaf8	T	G	1: 172,189,035	I463S	possibly damaging	Het
Dcp1b	G	T	6: 119,206,512	A187S	possibly damaging	Het
Ddo	T	A	10: 40,632,939	D58E	possibly damaging	Het
Dkkl1	G	T	7: 45,207,733	R137S	probably damaging	Het
Dxo	A	G	17: 34,837,742	N115S	probably benign	Het
Ep400	A	T	5: 110,708,915		probably benign	Het
F11	A	G	8: 45,261,061	V7A	probably benign	Het
Fermt1	G	T	2: 132,939,518		probably null	Het
Fign	A	T	2: 63,979,799	F376I	probably benign	Het
Flg2	G	T	3: 93,201,775	G370V	probably damaging	Het
Fndc3a	A	T	14: 72,556,275	D953E	probably benign	Het
Fsip2	A	T	2: 82,978,167	H1610L	probably benign	Het
Gfra3	T	C	18: 34,704,511	N145D	probably benign	Het
Inpp4b	G	T	8: 82,010,550	W525C	probably damaging	Het
Kremen1	CGGG	CGGGGGG	11: 5,201,791		probably benign	Het
Lgi2	A	G	5: 52,537,965	*543R	probably null	Het
Lyn	A	G	4: 3,745,542	T114A	probably benign	Het
Lynx1	A	G	15: 74,751,320	Y88H	probably damaging	Het
Map4	C	A	9: 110,034,702	P332T	possibly damaging	Het
Mapk8ip3	A	T	17: 24,914,703	C250*	probably null	Het
Metap1d	A	G	2: 71,522,610	H261R	probably damaging	Het
Mfrp	T	C	9: 44,102,538	V115A	probably benign	Het
Mtbp	A	G	15: 55,577,536	Y373C	probably damaging	Het
Mtor	C	A	4: 148,530,491	R1628S	possibly damaging	Het
Muc5b	A	G	7: 141,859,076	N1920D	unknown	Het
Myo1d	T	A	11: 80,779,717	M26L	probably benign	Het
Neb	A	C	2: 52,210,831	D643E	probably damaging	Het
Nme1	A	G	11: 93,960,687	F108L	possibly damaging	Het
Olfr458	A	G	6: 42,460,273	S249P	probably damaging	Het
Olfr893	G	T	9: 38,209,374	C54F	probably damaging	Het
Pan2	T	A	10: 128,304,457	D82E	probably damaging	Het
Pclo	A	G	5: 14,712,598	D3695G	unknown	Het
Pcnx4	A	T	12: 72,556,799		probably null	Het
Plg	A	G	17: 12,403,229	T479A	probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Ranbp3l	A	G	15: 8,968,465	T14A	probably benign	Het
Rcc1l	A	T	5: 134,166,669	V230D	probably damaging	Het
Reln	T	C	5: 21,979,690	D1609G	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Ryr1	G	A	7: 29,103,542	L696F	possibly damaging	Het
Sacs	T	A	14: 61,203,080	D858E	probably benign	Het
Sec16a	C	T	2: 26,439,025	V993I	probably benign	Het
Skint5	T	A	4: 113,630,419	I901F	unknown	Het
Slc17a3	A	T	13: 23,846,247	I114F	probably benign	Het
Slc17a7	T	A	7: 45,168,864	L71Q	probably damaging	Het
Slc43a2	T	C	11: 75,570,577	S452P	probably damaging	Het
Smarca4	A	G	9: 21,635,698	N173S	possibly damaging	Het
Tbc1d21	T	C	9: 58,362,912	Y161C	probably damaging	Het
Tpsab1	C	A	17: 25,345,107	C94F	probably damaging	Het
Ubr5	G	A	15: 38,002,319	P1496L	probably damaging	Het
Unc80	G	T	1: 66,671,608	A2679S	possibly damaging	Het
Vdac1	T	A	11: 52,384,077	V184E	probably damaging	Het
Vmn2r24	T	A	6: 123,787,026	S287R	probably benign	Het
Vmn2r91	T	C	17: 18,135,786	F572L	probably benign	Het
Vps13b	G	A	15: 35,884,555	E3125K	probably benign	Het
Ythdf3	A	G	3: 16,204,895	N406S	possibly damaging	Het
Zfp708	T	C	13: 67,071,187	K158E	probably damaging	Het

Other mutations in Ptgis

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01562:Ptgis	APN	2	167206830	missense	probably damaging	1.00
IGL01859:Ptgis	APN	2	167214806	critical splice donor site	probably null
IGL01965:Ptgis	APN	2	167208253	missense	probably benign	0.00
IGL02102:Ptgis	APN	2	167225447	missense	probably damaging	0.99
IGL02296:Ptgis	APN	2	167206737	missense	probably damaging	1.00
IGL02434:Ptgis	APN	2	167240342	critical splice donor site	probably null
PIT4142001:Ptgis	UTSW	2	167206830	missense	probably damaging	1.00
R0332:Ptgis	UTSW	2	167214833	missense	probably damaging	0.99
R0614:Ptgis	UTSW	2	167206882	missense	probably damaging	1.00
R1733:Ptgis	UTSW	2	167191968	unclassified	probably benign
R1756:Ptgis	UTSW	2	167206803	missense	probably damaging	1.00
R1779:Ptgis	UTSW	2	167214858	missense	probably benign	0.01
R2004:Ptgis	UTSW	2	167214849	missense	possibly damaging	0.94
R2019:Ptgis	UTSW	2	167208279	missense	probably damaging	1.00
R2019:Ptgis	UTSW	2	167214810	nonsense	probably null
R2679:Ptgis	UTSW	2	167208193	missense	probably benign	0.38
R4962:Ptgis	UTSW	2	167225274	critical splice donor site	probably null
R5174:Ptgis	UTSW	2	167203470	critical splice acceptor site	probably null
R5471:Ptgis	UTSW	2	167224119	missense	probably benign	0.03
R5717:Ptgis	UTSW	2	167208364	splice site	probably benign
R7268:Ptgis	UTSW	2	167206756	missense	probably benign	0.10
R7513:Ptgis	UTSW	2	167225283	missense	probably benign	0.00
R7515:Ptgis	UTSW	2	167206838	missense	possibly damaging	0.91
R7615:Ptgis	UTSW	2	167223988	missense	probably damaging	1.00
R7736:Ptgis	UTSW	2	167191971	missense	unknown
R7891:Ptgis	UTSW	2	167227514	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACACCCGGTTACCACTCAG -3'
(R):5'- TACAAGGTACACACCCTCTGGTC -3'

Sequencing Primer
(F):5'- GTTACCACTCAGGGCTGACTAAAG -3'
(R):5'- CCTTGCTCTGTTAAACAAGAACGGG -3'

Posted On

2014-12-04