Incidental Mutation 'R2869:Olfr419'
ID253393
Institutional Source Beutler Lab
Gene Symbol Olfr419
Ensembl Gene ENSMUSG00000050788
Gene Nameolfactory receptor 419
SynonymsMOR267-6, GA_x6K02T2P20D-20891507-20892448
MMRRC Submission 040457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R2869 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174248514-174252061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174250526 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 134 (S134G)
Ref Sequence ENSEMBL: ENSMUSP00000149512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000061990] [ENSMUST00000214725]
Predicted Effect probably benign
Transcript: ENSMUST00000027817
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061990
AA Change: S134G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050893
Gene: ENSMUSG00000050788
AA Change: S134G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-53 PFAM
Pfam:7tm_1 41 290 3.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156092
Predicted Effect probably benign
Transcript: ENSMUST00000214725
AA Change: S134G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1580 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.4%
  • 10x: 93.9%
  • 20x: 77.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lzts2 C A 19: 45,024,095 S321* probably null Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Serinc2 A G 4: 130,265,212 S29P probably damaging Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Olfr419
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Olfr419 APN 1 174250526 missense probably benign 0.41
IGL01765:Olfr419 APN 1 174250137 missense probably damaging 1.00
IGL02718:Olfr419 APN 1 174250707 nonsense probably null
IGL03208:Olfr419 APN 1 174250393 missense probably damaging 1.00
R1406:Olfr419 UTSW 1 174250861 missense possibly damaging 0.51
R1406:Olfr419 UTSW 1 174250861 missense possibly damaging 0.51
R1760:Olfr419 UTSW 1 174250360 missense probably damaging 0.99
R2138:Olfr419 UTSW 1 174250736 unclassified probably null
R2139:Olfr419 UTSW 1 174250736 unclassified probably null
R2869:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2871:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2871:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2872:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2872:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2873:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R2874:Olfr419 UTSW 1 174250526 missense probably benign 0.41
R3854:Olfr419 UTSW 1 174250150 missense probably damaging 1.00
R4614:Olfr419 UTSW 1 174250622 missense possibly damaging 0.93
R4858:Olfr419 UTSW 1 174250696 missense probably damaging 1.00
R5015:Olfr419 UTSW 1 174250882 missense possibly damaging 0.91
R5138:Olfr419 UTSW 1 174250829 missense probably damaging 0.97
R5296:Olfr419 UTSW 1 174250756 missense possibly damaging 0.75
R5369:Olfr419 UTSW 1 174250441 missense probably damaging 1.00
R6285:Olfr419 UTSW 1 174250829 missense possibly damaging 0.62
R7655:Olfr419 UTSW 1 174250218 missense probably damaging 1.00
R7656:Olfr419 UTSW 1 174250218 missense probably damaging 1.00
R7753:Olfr419 UTSW 1 174250670 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGATGAGGATTCCCAGTTCAC -3'
(R):5'- TCTGAGACCTGCTACACATTG -3'

Sequencing Primer
(F):5'- GATGAGGATTCCCAGTTCACTTAGC -3'
(R):5'- TGAGACCTGCTACACATTGGGAATC -3'
Posted On2014-12-04