Incidental Mutation 'R2869:Parp1'
ID253395
Institutional Source Beutler Lab
Gene Symbol Parp1
Ensembl Gene ENSMUSG00000026496
Gene Namepoly (ADP-ribose) polymerase family, member 1
SynonymsAdprp, 5830444G22Rik, PARP, sPARP-1, parp-1, Adprt1
MMRRC Submission 040457-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.505) question?
Stock #R2869 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location180568924-180601254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180573665 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 45 (D45G)
Ref Sequence ENSEMBL: ENSMUSP00000142295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027777] [ENSMUST00000194434] [ENSMUST00000194608]
Predicted Effect probably damaging
Transcript: ENSMUST00000027777
AA Change: D45G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027777
Gene: ENSMUSG00000026496
AA Change: D45G

DomainStartEndE-ValueType
zf-PARP 12 90 4.73e-36 SMART
zf-PARP 116 200 3.99e-34 SMART
low complexity region 221 234 N/A INTRINSIC
PADR1 280 333 1.48e-28 SMART
low complexity region 359 378 N/A INTRINSIC
BRCT 388 467 9.62e-7 SMART
low complexity region 494 512 N/A INTRINSIC
WGR 553 633 2.36e-31 SMART
Pfam:PARP_reg 663 794 4e-54 PFAM
Pfam:PARP 797 1007 6.4e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194434
AA Change: D3G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141775
Gene: ENSMUSG00000026496
AA Change: D3G

DomainStartEndE-ValueType
Pfam:zf-PARP 1 48 3.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194608
AA Change: D45G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142295
Gene: ENSMUSG00000026496
AA Change: D45G

DomainStartEndE-ValueType
zf-PARP 12 68 2.9e-20 SMART
Meta Mutation Damage Score 0.8362 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.4%
  • 10x: 93.9%
  • 20x: 77.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous ablation of this gene may lead to skin hyperplasia, extreme sensitivity to radiation and alkylating agents, abnormal response to xenobiotics and endogenous compounds, reduced noise-induced hearing loss, altered susceptibility to neurotoxicity,or protection against renal ischemic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lzts2 C A 19: 45,024,095 S321* probably null Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Serinc2 A G 4: 130,265,212 S29P probably damaging Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Parp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Parp1 APN 1 180589580 missense probably damaging 0.99
IGL01316:Parp1 APN 1 180592935 splice site probably benign
IGL01915:Parp1 APN 1 180598342 missense probably damaging 1.00
IGL02016:Parp1 APN 1 180598951 unclassified probably null
IGL03328:Parp1 APN 1 180599590 splice site probably benign
IGL03348:Parp1 APN 1 180577707 splice site probably benign
IGL03368:Parp1 APN 1 180580622 missense probably benign 0.01
R0541:Parp1 UTSW 1 180599051 missense probably benign 0.05
R0648:Parp1 UTSW 1 180600440 splice site probably benign
R1326:Parp1 UTSW 1 180600458 missense probably damaging 1.00
R1421:Parp1 UTSW 1 180600088 splice site probably benign
R1438:Parp1 UTSW 1 180591242 missense probably benign 0.08
R1781:Parp1 UTSW 1 180588013 missense probably benign 0.04
R1800:Parp1 UTSW 1 180600526 intron probably null
R1900:Parp1 UTSW 1 180597339 missense probably damaging 0.98
R1903:Parp1 UTSW 1 180588670 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2873:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2874:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R4342:Parp1 UTSW 1 180587329 missense probably benign 0.00
R4510:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4511:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4529:Parp1 UTSW 1 180591312 missense probably damaging 1.00
R4740:Parp1 UTSW 1 180589468 missense probably damaging 0.99
R4876:Parp1 UTSW 1 180569035 start codon destroyed probably null 1.00
R6666:Parp1 UTSW 1 180585951 missense probably benign
R6766:Parp1 UTSW 1 180598362 missense probably damaging 1.00
R6918:Parp1 UTSW 1 180588670 missense possibly damaging 0.46
R6974:Parp1 UTSW 1 180589506 nonsense probably null
R6996:Parp1 UTSW 1 180587371 missense possibly damaging 0.46
R7034:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7036:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7068:Parp1 UTSW 1 180588668 missense probably damaging 1.00
R7156:Parp1 UTSW 1 180599064 missense possibly damaging 0.91
R7326:Parp1 UTSW 1 180569100 missense possibly damaging 0.94
R7603:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7733:Parp1 UTSW 1 180600212 critical splice donor site probably null
R7772:Parp1 UTSW 1 180589398 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TACCCAGGATGAGAAGCCAG -3'
(R):5'- ATCCATGCAAGCTTAAAGTCTTCC -3'

Sequencing Primer
(F):5'- AGAAGCTGTTTCTCATCCATTTG -3'
(R):5'- AGAGAGAGCGCTTGAACCCC -3'
Posted On2014-12-04