Incidental Mutation 'R2512:C87499'
ID253398
Institutional Source Beutler Lab
Gene Symbol C87499
Ensembl Gene ENSMUSG00000038330
Gene Nameexpressed sequence C87499
Synonyms
MMRRC Submission 040418-MU
Accession Numbers

Ncbi RefSeq:NM_198663.3; MGI:2140706

Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R2512 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location88627320-88634411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88628958 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 246 (M246L)
Ref Sequence ENSEMBL: ENSMUSP00000056691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053304] [ENSMUST00000107142] [ENSMUST00000107143] [ENSMUST00000134155] [ENSMUST00000156062]
Predicted Effect probably damaging
Transcript: ENSMUST00000053304
AA Change: M246L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056691
Gene: ENSMUSG00000038330
AA Change: M246L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 425 4e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107142
Predicted Effect probably benign
Transcript: ENSMUST00000107143
Predicted Effect possibly damaging
Transcript: ENSMUST00000134155
AA Change: M75L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000156062
AA Change: M159L

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,726 T60A probably benign Het
2700049A03Rik A G 12: 71,173,171 T831A possibly damaging Het
Actg2 T A 6: 83,526,847 I72F probably damaging Het
Add1 A G 5: 34,616,686 T80A probably benign Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Aplp2 C T 9: 31,167,677 R325H probably damaging Het
Aptx G A 4: 40,694,917 P140S probably benign Het
Carm1 A G 9: 21,575,412 probably null Het
Carmil2 A T 8: 105,697,393 I1293F probably benign Het
Cdh8 T C 8: 99,400,863 T39A probably benign Het
Col15a1 T A 4: 47,245,868 N206K possibly damaging Het
Copg2 C T 6: 30,896,656 probably null Het
Ctr9 T G 7: 111,046,871 I690S probably damaging Het
Dcaf8 T G 1: 172,189,035 I463S possibly damaging Het
Dcp1b G T 6: 119,206,512 A187S possibly damaging Het
Ddo T A 10: 40,632,939 D58E possibly damaging Het
Dkkl1 G T 7: 45,207,733 R137S probably damaging Het
Dxo A G 17: 34,837,742 N115S probably benign Het
Ep400 A T 5: 110,708,915 probably benign Het
F11 A G 8: 45,261,061 V7A probably benign Het
Fermt1 G T 2: 132,939,518 probably null Het
Fign A T 2: 63,979,799 F376I probably benign Het
Flg2 G T 3: 93,201,775 G370V probably damaging Het
Fndc3a A T 14: 72,556,275 D953E probably benign Het
Fsip2 A T 2: 82,978,167 H1610L probably benign Het
Gfra3 T C 18: 34,704,511 N145D probably benign Het
Inpp4b G T 8: 82,010,550 W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lgi2 A G 5: 52,537,965 *543R probably null Het
Lyn A G 4: 3,745,542 T114A probably benign Het
Lynx1 A G 15: 74,751,320 Y88H probably damaging Het
Map4 C A 9: 110,034,702 P332T possibly damaging Het
Mapk8ip3 A T 17: 24,914,703 C250* probably null Het
Metap1d A G 2: 71,522,610 H261R probably damaging Het
Mfrp T C 9: 44,102,538 V115A probably benign Het
Mtbp A G 15: 55,577,536 Y373C probably damaging Het
Mtor C A 4: 148,530,491 R1628S possibly damaging Het
Muc5b A G 7: 141,859,076 N1920D unknown Het
Myo1d T A 11: 80,779,717 M26L probably benign Het
Neb A C 2: 52,210,831 D643E probably damaging Het
Nme1 A G 11: 93,960,687 F108L possibly damaging Het
Olfr458 A G 6: 42,460,273 S249P probably damaging Het
Olfr893 G T 9: 38,209,374 C54F probably damaging Het
Pan2 T A 10: 128,304,457 D82E probably damaging Het
Pclo A G 5: 14,712,598 D3695G unknown Het
Pcnx4 A T 12: 72,556,799 probably null Het
Plg A G 17: 12,403,229 T479A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptgis T C 2: 167,207,276 D372G probably damaging Het
Ranbp3l A G 15: 8,968,465 T14A probably benign Het
Rcc1l A T 5: 134,166,669 V230D probably damaging Het
Reln T C 5: 21,979,690 D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr1 G A 7: 29,103,542 L696F possibly damaging Het
Sacs T A 14: 61,203,080 D858E probably benign Het
Sec16a C T 2: 26,439,025 V993I probably benign Het
Skint5 T A 4: 113,630,419 I901F unknown Het
Slc17a3 A T 13: 23,846,247 I114F probably benign Het
Slc17a7 T A 7: 45,168,864 L71Q probably damaging Het
Slc43a2 T C 11: 75,570,577 S452P probably damaging Het
Smarca4 A G 9: 21,635,698 N173S possibly damaging Het
Tbc1d21 T C 9: 58,362,912 Y161C probably damaging Het
Tpsab1 C A 17: 25,345,107 C94F probably damaging Het
Ubr5 G A 15: 38,002,319 P1496L probably damaging Het
Unc80 G T 1: 66,671,608 A2679S possibly damaging Het
Vdac1 T A 11: 52,384,077 V184E probably damaging Het
Vmn2r24 T A 6: 123,787,026 S287R probably benign Het
Vmn2r91 T C 17: 18,135,786 F572L probably benign Het
Vps13b G A 15: 35,884,555 E3125K probably benign Het
Ythdf3 A G 3: 16,204,895 N406S possibly damaging Het
Zfp708 T C 13: 67,071,187 K158E probably damaging Het
Other mutations in C87499
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:C87499 APN 4 88629070 missense probably benign 0.43
IGL00229:C87499 APN 4 88629053 missense probably damaging 0.99
IGL01938:C87499 APN 4 88629363 missense possibly damaging 0.90
IGL02321:C87499 APN 4 88630103 missense probably benign 0.33
IGL02351:C87499 APN 4 88627890 missense probably damaging 1.00
IGL02358:C87499 APN 4 88627890 missense probably damaging 1.00
P0005:C87499 UTSW 4 88627950 missense probably damaging 1.00
R0521:C87499 UTSW 4 88629322 missense probably damaging 0.96
R0578:C87499 UTSW 4 88634139 missense probably benign 0.01
R0600:C87499 UTSW 4 88629299 missense probably damaging 1.00
R0750:C87499 UTSW 4 88627668 missense probably benign 0.01
R1483:C87499 UTSW 4 88628834 missense probably damaging 1.00
R1502:C87499 UTSW 4 88628032 missense probably benign 0.00
R1911:C87499 UTSW 4 88630072 missense possibly damaging 0.93
R2204:C87499 UTSW 4 88628118 missense probably damaging 0.99
R2507:C87499 UTSW 4 88629211 missense possibly damaging 0.89
R4299:C87499 UTSW 4 88628182 missense probably damaging 0.97
R4498:C87499 UTSW 4 88628892 splice site probably null
R4656:C87499 UTSW 4 88629965 missense probably benign 0.41
R4787:C87499 UTSW 4 88629213 nonsense probably null
R4823:C87499 UTSW 4 88629215 missense probably damaging 1.00
R4885:C87499 UTSW 4 88627982 missense possibly damaging 0.50
R4948:C87499 UTSW 4 88628948 missense probably damaging 1.00
R4967:C87499 UTSW 4 88629195 missense probably damaging 1.00
R5229:C87499 UTSW 4 88630135 missense possibly damaging 0.92
R5426:C87499 UTSW 4 88629410 intron probably benign
R5520:C87499 UTSW 4 88630040 missense probably damaging 1.00
R5574:C87499 UTSW 4 88628043 missense probably benign 0.10
R5596:C87499 UTSW 4 88630055 missense probably damaging 1.00
R6282:C87499 UTSW 4 88630054 missense probably damaging 1.00
R6366:C87499 UTSW 4 88628865 missense probably damaging 0.99
R6808:C87499 UTSW 4 88630054 missense probably damaging 1.00
R6866:C87499 UTSW 4 88627740 missense probably damaging 1.00
R7105:C87499 UTSW 4 88630102 missense probably damaging 0.98
R7117:C87499 UTSW 4 88628958 missense probably damaging 0.99
R7319:C87499 UTSW 4 88629947 missense probably benign 0.25
R7345:C87499 UTSW 4 88628179 missense possibly damaging 0.88
R7399:C87499 UTSW 4 88627965 missense probably benign 0.01
R7626:C87499 UTSW 4 88630042 missense probably damaging 1.00
R7751:C87499 UTSW 4 88629119 missense probably benign 0.05
R8044:C87499 UTSW 4 88629975 missense possibly damaging 0.47
RF012:C87499 UTSW 4 88627769 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTACTCCCTAGCTTGAGGAGG -3'
(R):5'- ACATACTTGTTGCAGTGGGC -3'

Sequencing Primer
(F):5'- GAGATGTCTTCTTACCTGAGGCATTC -3'
(R):5'- CTGAGCAGAGAAAAGATTCCATTC -3'
Posted On2014-12-04