Incidental Mutation 'R0313:Cldn18'
ID25340
Institutional Source Beutler Lab
Gene Symbol Cldn18
Ensembl Gene ENSMUSG00000032473
Gene Nameclaudin 18
Synonyms
MMRRC Submission 038523-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0313 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99689461-99717267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99698914 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 94 (I94V)
Ref Sequence ENSEMBL: ENSMUSP00000115782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035048] [ENSMUST00000112882] [ENSMUST00000131922] [ENSMUST00000136429]
Predicted Effect probably benign
Transcript: ENSMUST00000035048
AA Change: I94V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000035048
Gene: ENSMUSG00000032473
AA Change: I94V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 195 1e-28 PFAM
Pfam:Claudin_2 15 197 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112882
AA Change: I94V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108503
Gene: ENSMUSG00000032473
AA Change: I94V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 195 4.2e-30 PFAM
Pfam:Claudin_2 15 197 4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131922
AA Change: I94V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117382
Gene: ENSMUSG00000032473
AA Change: I94V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 195 1.9e-30 PFAM
Pfam:Claudin_2 15 197 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136429
AA Change: I94V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000115782
Gene: ENSMUSG00000032473
AA Change: I94V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 195 4e-29 PFAM
Pfam:Claudin_2 6 197 1e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.9%
  • 20x: 88.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is a downstream target gene regulated by the T/EBP/NKX2.1 homeodomain transcription factor. Four alternatively spliced transcript variants resulted from alternative promoters and alternative splicing have been identified, which encode two lung-specific isoforms and two stomach-specific isoforms respectively. This gene is also expressed in colons, inner ear and skin, and its expression is increased in both experimental colitis and ulcerative colitis. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone resorption and osteoclast differentiation. Homozygotes for another knock-out allele have impiared alveolarization and alveolar epithelial barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 A G 6: 58,672,097 E309G probably benign Het
AI314180 A G 4: 58,811,892 I1411T probably benign Het
Ankmy1 C T 1: 92,886,221 G412D probably damaging Het
Cc2d1a G A 8: 84,136,969 T542I probably benign Het
Cobll1 G A 2: 65,095,744 R1195* probably null Het
Dnah7b A G 1: 46,207,643 T1660A probably damaging Het
Dzip3 G T 16: 48,937,061 Q870K probably damaging Het
Ebf4 T C 2: 130,306,787 probably benign Het
Esyt2 T C 12: 116,347,808 L439P probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Haspin A G 11: 73,136,298 V655A probably damaging Het
Kmt2c T C 5: 25,344,930 E1351G probably damaging Het
Lama2 C A 10: 26,993,398 probably null Het
Lcp1 A G 14: 75,199,433 E73G probably damaging Het
Ltv1 C T 10: 13,182,860 probably null Het
Mcmdc2 A G 1: 9,932,141 Y529C probably damaging Het
Myo3b T A 2: 70,348,959 Y1172* probably null Het
Ncf1 T C 5: 134,229,567 M1V probably null Het
Olfr1297 C T 2: 111,621,600 S158N possibly damaging Het
Olfr250 T C 9: 38,368,304 S243P probably damaging Het
Olfr765 A G 10: 129,046,826 V79A possibly damaging Het
Pcif1 A T 2: 164,884,419 H80L probably damaging Het
Pclo T C 5: 14,678,873 probably benign Het
Polr2a T C 11: 69,735,080 Y1710C unknown Het
Ppp1r37 G A 7: 19,533,998 T324I probably damaging Het
Prmt1 T C 7: 44,978,748 D176G probably benign Het
Scn5a T C 9: 119,534,571 D501G probably damaging Het
Ska2 A G 11: 87,117,814 I89M possibly damaging Het
Slc39a7 G A 17: 34,029,544 A375V probably damaging Het
Ssrp1 T A 2: 85,041,554 I374N probably damaging Het
Stox2 C T 8: 47,192,134 G828R probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Uqcrc1 C A 9: 108,948,574 R114S possibly damaging Het
Usp38 A T 8: 80,984,442 L988* probably null Het
Vmn2r5 T A 3: 64,503,827 H440L probably benign Het
Wdr12 A T 1: 60,082,579 I271N possibly damaging Het
Xylt2 C T 11: 94,669,894 probably benign Het
Other mutations in Cldn18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Cldn18 APN 9 99698821 missense probably benign 0.29
IGL01317:Cldn18 APN 9 99696082 missense probably benign
IGL01804:Cldn18 APN 9 99698848 nonsense probably null
IGL02112:Cldn18 APN 9 99698075 missense probably benign 0.11
IGL02471:Cldn18 APN 9 99696075 missense probably benign 0.04
IGL02619:Cldn18 APN 9 99698935 missense probably damaging 0.97
R5384:Cldn18 UTSW 9 99709858 missense possibly damaging 0.93
R6337:Cldn18 UTSW 9 99709942 missense probably benign 0.09
R6419:Cldn18 UTSW 9 99692748 missense possibly damaging 0.65
Z1176:Cldn18 UTSW 9 99698847 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATCTCGAATCCCAGTGTGAAACACC -3'
(R):5'- ACAAGTGATGCCTTTTGGCATTTCC -3'

Sequencing Primer
(F):5'- CAGTGTGAAACACCTTGAGC -3'
(R):5'- AACTCCACATTTTTGCACAGTG -3'
Posted On2013-04-16