Incidental Mutation 'R2512:Mtor'
ID 253404
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Name mechanistic target of rapamycin kinase
Synonyms flat, 2610315D21Rik, RAPT1, RAFT1, mechanistic target of rapamycin (serine/threonine kinase), FKBP-rapamycin-associated protein FRAP, Frap1
MMRRC Submission 040418-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2512 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 148533068-148642140 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 148614948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1628 (R1628S)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
AlphaFold Q9JLN9
Predicted Effect possibly damaging
Transcript: ENSMUST00000103221
AA Change: R1628S

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: R1628S

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,219,945 (GRCm39) T831A possibly damaging Het
Actg2 T A 6: 83,503,829 (GRCm39) I72F probably damaging Het
Add1 A G 5: 34,774,030 (GRCm39) T80A probably benign Het
Alpk2 G A 18: 65,483,591 (GRCm39) T139M probably damaging Het
Aplp2 C T 9: 31,078,973 (GRCm39) R325H probably damaging Het
Aptx G A 4: 40,694,917 (GRCm39) P140S probably benign Het
Carm1 A G 9: 21,486,708 (GRCm39) probably null Het
Carmil2 A T 8: 106,424,025 (GRCm39) I1293F probably benign Het
Cdh8 T C 8: 100,127,495 (GRCm39) T39A probably benign Het
Cimip3 T C 17: 47,724,651 (GRCm39) T60A probably benign Het
Col15a1 T A 4: 47,245,868 (GRCm39) N206K possibly damaging Het
Copg2 C T 6: 30,873,591 (GRCm39) probably null Het
Ctr9 T G 7: 110,646,078 (GRCm39) I690S probably damaging Het
Dcaf8 T G 1: 172,016,602 (GRCm39) I463S possibly damaging Het
Dcp1b G T 6: 119,183,473 (GRCm39) A187S possibly damaging Het
Ddo T A 10: 40,508,935 (GRCm39) D58E possibly damaging Het
Dkkl1 G T 7: 44,857,157 (GRCm39) R137S probably damaging Het
Dxo A G 17: 35,056,718 (GRCm39) N115S probably benign Het
Ep400 A T 5: 110,856,781 (GRCm39) probably benign Het
F11 A G 8: 45,714,098 (GRCm39) V7A probably benign Het
Fermt1 G T 2: 132,781,438 (GRCm39) probably null Het
Fign A T 2: 63,810,143 (GRCm39) F376I probably benign Het
Flg2 G T 3: 93,109,082 (GRCm39) G370V probably damaging Het
Fndc3a A T 14: 72,793,715 (GRCm39) D953E probably benign Het
Fsip2 A T 2: 82,808,511 (GRCm39) H1610L probably benign Het
Gfra3 T C 18: 34,837,564 (GRCm39) N145D probably benign Het
Inpp4b G T 8: 82,737,179 (GRCm39) W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,151,791 (GRCm39) probably benign Het
Lgi2 A G 5: 52,695,307 (GRCm39) *543R probably null Het
Lyn A G 4: 3,745,542 (GRCm39) T114A probably benign Het
Lynx1 A G 15: 74,623,169 (GRCm39) Y88H probably damaging Het
Map4 C A 9: 109,863,770 (GRCm39) P332T possibly damaging Het
Mapk8ip3 A T 17: 25,133,677 (GRCm39) C250* probably null Het
Metap1d A G 2: 71,352,954 (GRCm39) H261R probably damaging Het
Mfrp T C 9: 44,013,835 (GRCm39) V115A probably benign Het
Mtbp A G 15: 55,440,932 (GRCm39) Y373C probably damaging Het
Muc5b A G 7: 141,412,813 (GRCm39) N1920D unknown Het
Myo1d T A 11: 80,670,543 (GRCm39) M26L probably benign Het
Neb A C 2: 52,100,843 (GRCm39) D643E probably damaging Het
Nme1 A G 11: 93,851,513 (GRCm39) F108L possibly damaging Het
Or2r11 A G 6: 42,437,207 (GRCm39) S249P probably damaging Het
Or8c15 G T 9: 38,120,670 (GRCm39) C54F probably damaging Het
Pan2 T A 10: 128,140,326 (GRCm39) D82E probably damaging Het
Pclo A G 5: 14,762,612 (GRCm39) D3695G unknown Het
Pcnx4 A T 12: 72,603,573 (GRCm39) probably null Het
Plg A G 17: 12,622,116 (GRCm39) T479A probably benign Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Pramel32 T G 4: 88,547,195 (GRCm39) M246L probably damaging Het
Ptgis T C 2: 167,049,196 (GRCm39) D372G probably damaging Het
Ranbp3l A G 15: 8,997,949 (GRCm39) T14A probably benign Het
Rcc1l A T 5: 134,195,508 (GRCm39) V230D probably damaging Het
Reln T C 5: 22,184,688 (GRCm39) D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Ryr1 G A 7: 28,802,967 (GRCm39) L696F possibly damaging Het
Sacs T A 14: 61,440,529 (GRCm39) D858E probably benign Het
Sec16a C T 2: 26,329,037 (GRCm39) V993I probably benign Het
Skint5 T A 4: 113,487,616 (GRCm39) I901F unknown Het
Slc17a3 A T 13: 24,030,230 (GRCm39) I114F probably benign Het
Slc17a7 T A 7: 44,818,288 (GRCm39) L71Q probably damaging Het
Slc43a2 T C 11: 75,461,403 (GRCm39) S452P probably damaging Het
Smarca4 A G 9: 21,546,994 (GRCm39) N173S possibly damaging Het
Tbc1d21 T C 9: 58,270,195 (GRCm39) Y161C probably damaging Het
Tpsab1 C A 17: 25,564,081 (GRCm39) C94F probably damaging Het
Ubr5 G A 15: 38,002,563 (GRCm39) P1496L probably damaging Het
Unc80 G T 1: 66,710,767 (GRCm39) A2679S possibly damaging Het
Vdac1 T A 11: 52,274,904 (GRCm39) V184E probably damaging Het
Vmn2r24 T A 6: 123,763,985 (GRCm39) S287R probably benign Het
Vmn2r91 T C 17: 18,356,048 (GRCm39) F572L probably benign Het
Vps13b G A 15: 35,884,701 (GRCm39) E3125K probably benign Het
Ythdf3 A G 3: 16,259,059 (GRCm39) N406S possibly damaging Het
Zfp708 T C 13: 67,219,251 (GRCm39) K158E probably damaging Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148,537,494 (GRCm39) missense probably benign 0.06
IGL01447:Mtor APN 4 148,615,214 (GRCm39) missense possibly damaging 0.62
IGL01551:Mtor APN 4 148,556,494 (GRCm39) missense probably damaging 0.99
IGL01661:Mtor APN 4 148,599,308 (GRCm39) missense possibly damaging 0.61
IGL01675:Mtor APN 4 148,569,111 (GRCm39) missense probably benign 0.00
IGL01743:Mtor APN 4 148,615,070 (GRCm39) splice site probably benign
IGL02015:Mtor APN 4 148,624,570 (GRCm39) nonsense probably null
IGL02084:Mtor APN 4 148,555,137 (GRCm39) missense probably damaging 0.98
IGL02095:Mtor APN 4 148,628,998 (GRCm39) missense probably damaging 1.00
IGL02129:Mtor APN 4 148,634,302 (GRCm39) missense possibly damaging 0.91
IGL02260:Mtor APN 4 148,622,758 (GRCm39) missense probably damaging 1.00
IGL02329:Mtor APN 4 148,619,396 (GRCm39) missense probably benign 0.16
IGL02440:Mtor APN 4 148,576,104 (GRCm39) missense probably benign 0.04
IGL02440:Mtor APN 4 148,630,886 (GRCm39) missense probably benign 0.24
IGL02449:Mtor APN 4 148,618,378 (GRCm39) missense possibly damaging 0.65
IGL02479:Mtor APN 4 148,555,041 (GRCm39) missense probably damaging 1.00
IGL02904:Mtor APN 4 148,576,069 (GRCm39) splice site probably benign
IGL02904:Mtor APN 4 148,536,851 (GRCm39) missense possibly damaging 0.55
IGL02931:Mtor APN 4 148,549,421 (GRCm39) missense probably benign 0.22
IGL03048:Mtor APN 4 148,630,847 (GRCm39) splice site probably benign
IGL03133:Mtor APN 4 148,568,776 (GRCm39) missense probably benign 0.01
IGL03142:Mtor APN 4 148,538,356 (GRCm39) missense probably benign 0.00
Brushes UTSW 4 148,548,205 (GRCm39) missense probably benign 0.00
Dynamo UTSW 4 148,547,367 (GRCm39) missense probably benign 0.00
engine UTSW 4 148,641,312 (GRCm39) splice site probably null
Erg UTSW 4 148,630,053 (GRCm39) missense probably damaging 1.00
Lindor UTSW 4 148,539,103 (GRCm39) missense probably damaging 1.00
motor UTSW 4 148,575,817 (GRCm39) missense possibly damaging 0.76
R4858_Mtor_211 UTSW 4 148,539,273 (GRCm39) makesense probably null
Vigor UTSW 4 148,623,356 (GRCm39) missense probably damaging 1.00
Vim UTSW 4 148,610,260 (GRCm39) critical splice donor site probably null
PIT4519001:Mtor UTSW 4 148,608,957 (GRCm39) missense probably damaging 1.00
R0045:Mtor UTSW 4 148,549,406 (GRCm39) missense probably benign 0.42
R0048:Mtor UTSW 4 148,623,338 (GRCm39) nonsense probably null
R0048:Mtor UTSW 4 148,623,338 (GRCm39) nonsense probably null
R0103:Mtor UTSW 4 148,618,359 (GRCm39) missense probably benign 0.05
R0112:Mtor UTSW 4 148,565,380 (GRCm39) missense probably damaging 1.00
R0137:Mtor UTSW 4 148,555,081 (GRCm39) missense possibly damaging 0.78
R0184:Mtor UTSW 4 148,549,428 (GRCm39) missense probably benign 0.05
R0208:Mtor UTSW 4 148,549,432 (GRCm39) missense probably benign 0.43
R0329:Mtor UTSW 4 148,568,837 (GRCm39) missense probably benign
R0330:Mtor UTSW 4 148,568,837 (GRCm39) missense probably benign
R0365:Mtor UTSW 4 148,570,507 (GRCm39) missense probably benign 0.01
R0537:Mtor UTSW 4 148,622,817 (GRCm39) missense probably damaging 1.00
R0542:Mtor UTSW 4 148,624,907 (GRCm39) missense probably benign 0.02
R0556:Mtor UTSW 4 148,553,837 (GRCm39) missense possibly damaging 0.88
R0613:Mtor UTSW 4 148,610,503 (GRCm39) missense possibly damaging 0.95
R0646:Mtor UTSW 4 148,568,811 (GRCm39) nonsense probably null
R0710:Mtor UTSW 4 148,548,848 (GRCm39) missense possibly damaging 0.73
R0791:Mtor UTSW 4 148,547,367 (GRCm39) missense probably benign 0.00
R0792:Mtor UTSW 4 148,547,367 (GRCm39) missense probably benign 0.00
R0866:Mtor UTSW 4 148,570,513 (GRCm39) missense probably benign 0.04
R0973:Mtor UTSW 4 148,634,645 (GRCm39) missense probably damaging 1.00
R1027:Mtor UTSW 4 148,624,456 (GRCm39) missense probably benign 0.03
R1028:Mtor UTSW 4 148,623,287 (GRCm39) missense possibly damaging 0.88
R1289:Mtor UTSW 4 148,554,764 (GRCm39) missense probably benign 0.10
R1416:Mtor UTSW 4 148,575,871 (GRCm39) nonsense probably null
R1465:Mtor UTSW 4 148,610,450 (GRCm39) splice site probably benign
R1506:Mtor UTSW 4 148,620,962 (GRCm39) splice site probably benign
R1624:Mtor UTSW 4 148,632,133 (GRCm39) missense probably damaging 1.00
R1695:Mtor UTSW 4 148,623,364 (GRCm39) missense probably benign 0.08
R1771:Mtor UTSW 4 148,555,081 (GRCm39) missense possibly damaging 0.78
R1800:Mtor UTSW 4 148,547,349 (GRCm39) missense probably benign 0.00
R1855:Mtor UTSW 4 148,637,546 (GRCm39) missense probably benign 0.02
R1857:Mtor UTSW 4 148,565,336 (GRCm39) missense probably damaging 1.00
R1867:Mtor UTSW 4 148,539,089 (GRCm39) missense probably damaging 0.97
R1954:Mtor UTSW 4 148,552,730 (GRCm39) missense probably damaging 1.00
R2054:Mtor UTSW 4 148,550,482 (GRCm39) missense probably benign 0.00
R2054:Mtor UTSW 4 148,547,309 (GRCm39) missense probably benign 0.05
R2099:Mtor UTSW 4 148,634,649 (GRCm39) nonsense probably null
R2148:Mtor UTSW 4 148,540,469 (GRCm39) missense possibly damaging 0.56
R2214:Mtor UTSW 4 148,623,327 (GRCm39) missense probably benign 0.39
R2281:Mtor UTSW 4 148,574,012 (GRCm39) missense probably benign 0.02
R2870:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2870:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2871:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2871:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2872:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2872:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R2873:Mtor UTSW 4 148,624,487 (GRCm39) missense probably benign 0.00
R4032:Mtor UTSW 4 148,621,209 (GRCm39) missense probably benign 0.03
R4073:Mtor UTSW 4 148,633,832 (GRCm39) missense probably damaging 0.99
R4273:Mtor UTSW 4 148,634,609 (GRCm39) missense probably benign 0.21
R4611:Mtor UTSW 4 148,570,576 (GRCm39) missense probably benign 0.03
R4858:Mtor UTSW 4 148,539,273 (GRCm39) makesense probably null
R4942:Mtor UTSW 4 148,556,599 (GRCm39) missense probably benign 0.03
R4967:Mtor UTSW 4 148,575,817 (GRCm39) missense possibly damaging 0.76
R4995:Mtor UTSW 4 148,610,209 (GRCm39) missense probably damaging 1.00
R5054:Mtor UTSW 4 148,641,312 (GRCm39) splice site probably null
R5215:Mtor UTSW 4 148,538,440 (GRCm39) missense probably benign
R5249:Mtor UTSW 4 148,548,189 (GRCm39) missense probably damaging 1.00
R5289:Mtor UTSW 4 148,550,549 (GRCm39) missense possibly damaging 0.88
R5365:Mtor UTSW 4 148,634,587 (GRCm39) missense probably damaging 0.99
R5498:Mtor UTSW 4 148,624,821 (GRCm39) missense possibly damaging 0.71
R5514:Mtor UTSW 4 148,630,901 (GRCm39) missense probably damaging 1.00
R5540:Mtor UTSW 4 148,539,165 (GRCm39) missense probably benign 0.01
R5600:Mtor UTSW 4 148,575,927 (GRCm39) missense probably damaging 1.00
R5615:Mtor UTSW 4 148,622,733 (GRCm39) missense possibly damaging 0.95
R5632:Mtor UTSW 4 148,553,463 (GRCm39) missense possibly damaging 0.94
R5641:Mtor UTSW 4 148,630,882 (GRCm39) missense probably damaging 0.98
R5834:Mtor UTSW 4 148,620,993 (GRCm39) missense possibly damaging 0.95
R5984:Mtor UTSW 4 148,623,284 (GRCm39) missense probably benign 0.02
R6056:Mtor UTSW 4 148,621,892 (GRCm39) missense probably benign 0.00
R6225:Mtor UTSW 4 148,605,794 (GRCm39) missense probably benign 0.04
R6262:Mtor UTSW 4 148,610,552 (GRCm39) missense possibly damaging 0.46
R6335:Mtor UTSW 4 148,550,384 (GRCm39) missense probably damaging 1.00
R6479:Mtor UTSW 4 148,635,457 (GRCm39) missense probably benign 0.16
R6543:Mtor UTSW 4 148,630,053 (GRCm39) missense probably damaging 1.00
R6711:Mtor UTSW 4 148,536,824 (GRCm39) missense possibly damaging 0.49
R6715:Mtor UTSW 4 148,623,004 (GRCm39) missense probably benign 0.00
R6744:Mtor UTSW 4 148,543,112 (GRCm39) missense probably benign 0.01
R6748:Mtor UTSW 4 148,634,641 (GRCm39) missense probably damaging 1.00
R6762:Mtor UTSW 4 148,622,938 (GRCm39) missense possibly damaging 0.47
R6836:Mtor UTSW 4 148,573,955 (GRCm39) missense possibly damaging 0.94
R6948:Mtor UTSW 4 148,621,209 (GRCm39) missense probably benign 0.12
R6979:Mtor UTSW 4 148,608,930 (GRCm39) missense possibly damaging 0.60
R6992:Mtor UTSW 4 148,548,932 (GRCm39) missense probably benign
R7271:Mtor UTSW 4 148,630,942 (GRCm39) missense possibly damaging 0.70
R7423:Mtor UTSW 4 148,640,801 (GRCm39) missense possibly damaging 0.77
R7434:Mtor UTSW 4 148,549,416 (GRCm39) missense probably benign 0.39
R7619:Mtor UTSW 4 148,547,252 (GRCm39) missense probably damaging 0.98
R7634:Mtor UTSW 4 148,536,807 (GRCm39) missense possibly damaging 0.53
R7697:Mtor UTSW 4 148,624,765 (GRCm39) nonsense probably null
R7737:Mtor UTSW 4 148,623,195 (GRCm39) missense possibly damaging 0.95
R7791:Mtor UTSW 4 148,547,397 (GRCm39) missense probably benign 0.00
R7858:Mtor UTSW 4 148,539,103 (GRCm39) missense probably damaging 1.00
R8035:Mtor UTSW 4 148,630,856 (GRCm39) missense probably benign 0.29
R8076:Mtor UTSW 4 148,610,260 (GRCm39) critical splice donor site probably null
R8078:Mtor UTSW 4 148,552,744 (GRCm39) missense probably benign
R8928:Mtor UTSW 4 148,623,356 (GRCm39) missense probably damaging 1.00
R9040:Mtor UTSW 4 148,548,205 (GRCm39) missense probably benign 0.00
R9116:Mtor UTSW 4 148,637,198 (GRCm39) missense probably benign
R9284:Mtor UTSW 4 148,543,537 (GRCm39) missense probably benign 0.03
R9310:Mtor UTSW 4 148,553,834 (GRCm39) missense probably benign 0.03
R9374:Mtor UTSW 4 148,599,397 (GRCm39) missense probably damaging 1.00
R9417:Mtor UTSW 4 148,622,776 (GRCm39) nonsense probably null
R9465:Mtor UTSW 4 148,624,839 (GRCm39) missense possibly damaging 0.92
R9492:Mtor UTSW 4 148,568,801 (GRCm39) missense probably damaging 1.00
R9499:Mtor UTSW 4 148,599,397 (GRCm39) missense probably damaging 1.00
R9516:Mtor UTSW 4 148,569,103 (GRCm39) missense probably benign 0.23
R9600:Mtor UTSW 4 148,632,092 (GRCm39) missense possibly damaging 0.82
R9622:Mtor UTSW 4 148,568,169 (GRCm39) missense probably damaging 0.99
X0025:Mtor UTSW 4 148,615,171 (GRCm39) missense probably benign 0.09
Z1176:Mtor UTSW 4 148,634,587 (GRCm39) missense possibly damaging 0.69
Z1176:Mtor UTSW 4 148,634,582 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGAACACGCAGCACACATG -3'
(R):5'- TGCCGAGATGGATCAACTCC -3'

Sequencing Primer
(F):5'- GGTTTGGTAACTGTCTCAAAGCCAC -3'
(R):5'- CACTAAGGTTTTATGAGCAAGAGCC -3'
Posted On 2014-12-04