Mutagenetix > Incidental Mutations

Incidental Mutation 'R2869:Slc39a8'

253407

Institutional Source

Beutler Lab

Gene Symbol

Slc39a8

Ensembl Gene

ENSMUSG00000053897

Gene Name

solute carrier family 39 (metal ion transporter), member 8

Synonyms

4933419D20Rik, BIGM103, ZIP8

MMRRC Submission

040457-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2869 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135825279-135888572 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 135886793 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000136634 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029810] [ENSMUST00000081978] [ENSMUST00000167390] [ENSMUST00000180196]

Predicted Effect

probably null
Transcript: ENSMUST00000029810

SMART Domains

Protein: ENSMUSP00000029810
Gene: ENSMUSG00000053897

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Zip	126	453	6.2e-76	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000081978

SMART Domains

Protein: ENSMUSP00000080640
Gene: ENSMUSG00000053897

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Zip	126	453	4.7e-72	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133810

Predicted Effect

probably null
Transcript: ENSMUST00000167390

SMART Domains

Protein: ENSMUSP00000128245
Gene: ENSMUSG00000053897

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Zip	126	453	4.7e-72	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000180196

SMART Domains

Protein: ENSMUSP00000136634
Gene: ENSMUSG00000053897

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Zip	126	453	4.7e-72	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.6%
3x: 98.4%
10x: 93.9%
20x: 77.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC39 family of solute-carrier genes, which show structural characteristics of zinc transporters. The encoded protein is glycosylated and found in the plasma membrane and mitochondria, and functions in the cellular import of zinc at the onset of inflammation. It is also thought to be the primary transporter of the toxic cation cadmium, which is found in cigarette smoke. Multiple transcript variants encoding different isoforms have been found for this gene. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Als2	A	G	1: 59,211,137	S483P	probably damaging	Het
Ccl27a	C	T	4: 41,769,640	R73Q	probably benign	Het
Cd6	A	G	19: 10,794,626	I307T	possibly damaging	Het
Ch25h	T	A	19: 34,474,810	H106L	probably benign	Het
Dhx57	A	T	17: 80,251,376	D1051E	probably benign	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Eif4enif1	C	T	11: 3,242,586	P805S	probably damaging	Het
Fam19a2	A	T	10: 123,704,365	H42L	possibly damaging	Het
Fan1	A	G	7: 64,363,190	I668T	probably benign	Het
Frmpd4	A	T	X: 167,477,247	D1166E	probably benign	Het
Gbp11	C	T	5: 105,331,000	D191N	probably benign	Het
Ggt6	A	T	11: 72,437,361	N229I	probably benign	Het
Gria2	G	A	3: 80,702,492	T670I	probably damaging	Het
Gsdme	A	T	6: 50,208,177	C432*	probably null	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hmcn1	A	T	1: 150,738,716	V1313D	possibly damaging	Het
Kcnb1	A	G	2: 167,105,935	L331P	probably damaging	Het
Klf8	A	T	X: 153,382,682	E82D	probably damaging	Het
Krt13	A	G	11: 100,117,649	S421P	unknown	Het
Lactbl1	G	A	4: 136,626,786	C37Y	probably damaging	Het
Lzts2	C	A	19: 45,024,095	S321*	probably null	Het
Meikin	T	C	11: 54,373,507	V103A	possibly damaging	Het
Mki67	G	A	7: 135,708,149	P191L	probably benign	Het
Mlxip	A	G	5: 123,452,667	M878V	probably benign	Het
Mpp7	G	A	18: 7,461,678	P65L	possibly damaging	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Nbn	T	A	4: 15,963,810	D70E	probably damaging	Het
Nomo1	C	A	7: 46,046,937	T293N	probably damaging	Het
Notum	A	G	11: 120,660,196	V48A	probably benign	Het
Nwd2	A	T	5: 63,800,328	I334L	probably benign	Het
Olfr419	T	C	1: 174,250,526	S134G	probably benign	Het
Olfr730	T	C	14: 50,186,354	T288A	probably benign	Het
Olfr801	A	T	10: 129,669,759	C253*	probably null	Het
Ostc	T	C	3: 130,703,508	N80S	probably damaging	Het
Otud4	T	A	8: 79,661,073	N300K	possibly damaging	Het
Palmd	T	C	3: 116,923,751	R366G	possibly damaging	Het
Parp1	A	G	1: 180,573,665	D45G	probably damaging	Het
Pes1	C	A	11: 3,976,834	T372K	probably benign	Het
Plcl1	A	T	1: 55,697,150	D550V	probably benign	Het
Ppp1r7	T	A	1: 93,357,863		probably null	Het
Prdx4	A	G	X: 155,340,464	V15A	probably benign	Het
Psmb8	T	C	17: 34,200,170	I146T	probably damaging	Het
Psmd13	A	T	7: 140,887,055	T116S	probably damaging	Het
Pzp	A	T	6: 128,485,556		probably null	Het
Serinc2	A	G	4: 130,265,212	S29P	probably damaging	Het
Sppl2c	C	T	11: 104,187,315	P314S	probably benign	Het
St5	A	T	7: 109,557,430	Y38N	probably benign	Het
St7	C	T	6: 17,819,277	P60L	probably damaging	Het
Stx3	A	T	19: 11,789,574	V91D	probably damaging	Het
Tnni3k	C	T	3: 154,938,750		probably null	Het
Tprg	T	C	16: 25,412,840	W189R	probably damaging	Het
Trim32	A	G	4: 65,614,457	D417G	probably damaging	Het
Vmn2r68	A	C	7: 85,233,626	M306R	probably benign	Het
Vwa7	G	A	17: 35,021,242	M395I	probably damaging	Het
Ybx3	G	A	6: 131,370,413	A253V	probably damaging	Het
Zfp53	A	T	17: 21,508,078	E124D	probably benign	Het

Other mutations in Slc39a8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00661:Slc39a8	APN	3	135858112	missense	probably benign
IGL00793:Slc39a8	APN	3	135884733	missense	probably benign	0.00
IGL02591:Slc39a8	APN	3	135884620	missense	probably damaging	1.00
IGL02868:Slc39a8	APN	3	135856026	missense	probably damaging	1.00
IGL03062:Slc39a8	APN	3	135886797	splice site	probably benign
IGL03144:Slc39a8	APN	3	135884210	missense	probably benign	0.01
IGL03329:Slc39a8	APN	3	135884713	missense	probably damaging	0.98
R1449:Slc39a8	UTSW	3	135826685	missense	probably benign	0.41
R2869:Slc39a8	UTSW	3	135886793	splice site	probably null
R2870:Slc39a8	UTSW	3	135886793	splice site	probably null
R2870:Slc39a8	UTSW	3	135886793	splice site	probably null
R2871:Slc39a8	UTSW	3	135886793	splice site	probably null
R2871:Slc39a8	UTSW	3	135886793	splice site	probably null
R2872:Slc39a8	UTSW	3	135886793	splice site	probably null
R2872:Slc39a8	UTSW	3	135886793	splice site	probably null
R2873:Slc39a8	UTSW	3	135886793	splice site	probably null
R2937:Slc39a8	UTSW	3	135886823	missense	probably benign	0.00
R3832:Slc39a8	UTSW	3	135849133	missense	probably damaging	0.96
R4669:Slc39a8	UTSW	3	135856011	missense	probably benign	0.35
R5057:Slc39a8	UTSW	3	135849029	missense	probably benign	0.00
R5098:Slc39a8	UTSW	3	135858157	missense	probably benign	0.01
R5677:Slc39a8	UTSW	3	135884688	missense	probably damaging	1.00
R6747:Slc39a8	UTSW	3	135849180	critical splice donor site	probably null
R7181:Slc39a8	UTSW	3	135857538	missense	possibly damaging	0.93
R7459:Slc39a8	UTSW	3	135886911	missense	probably damaging	1.00
R7506:Slc39a8	UTSW	3	135884306	missense	probably benign	0.03
R7589:Slc39a8	UTSW	3	135884362	missense	probably damaging	0.96
X0023:Slc39a8	UTSW	3	135826544	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGCATCAAGCCAGGTACATTC -3'
(R):5'- TCCCGCGTTGACGTTATAC -3'

Sequencing Primer
(F):5'- GCATCAAGCCAGGTACATTCTATCTG -3'
(R):5'- CGCGTTGACGTTATACTCCAC -3'

Posted On

2014-12-04