Incidental Mutation 'R2869:Slc39a8'
ID253407
Institutional Source Beutler Lab
Gene Symbol Slc39a8
Ensembl Gene ENSMUSG00000053897
Gene Namesolute carrier family 39 (metal ion transporter), member 8
Synonyms4933419D20Rik, BIGM103, ZIP8
MMRRC Submission 040457-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2869 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location135825279-135888572 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 135886793 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029810] [ENSMUST00000081978] [ENSMUST00000167390] [ENSMUST00000180196]
Predicted Effect probably null
Transcript: ENSMUST00000029810
SMART Domains Protein: ENSMUSP00000029810
Gene: ENSMUSG00000053897

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 6.2e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000081978
SMART Domains Protein: ENSMUSP00000080640
Gene: ENSMUSG00000053897

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133810
Predicted Effect probably null
Transcript: ENSMUST00000167390
SMART Domains Protein: ENSMUSP00000128245
Gene: ENSMUSG00000053897

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180196
SMART Domains Protein: ENSMUSP00000136634
Gene: ENSMUSG00000053897

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Zip 126 453 4.7e-72 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.4%
  • 10x: 93.9%
  • 20x: 77.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC39 family of solute-carrier genes, which show structural characteristics of zinc transporters. The encoded protein is glycosylated and found in the plasma membrane and mitochondria, and functions in the cellular import of zinc at the onset of inflammation. It is also thought to be the primary transporter of the toxic cation cadmium, which is found in cigarette smoke. Multiple transcript variants encoding different isoforms have been found for this gene. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lzts2 C A 19: 45,024,095 S321* probably null Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Serinc2 A G 4: 130,265,212 S29P probably damaging Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Slc39a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Slc39a8 APN 3 135858112 missense probably benign
IGL00793:Slc39a8 APN 3 135884733 missense probably benign 0.00
IGL02591:Slc39a8 APN 3 135884620 missense probably damaging 1.00
IGL02868:Slc39a8 APN 3 135856026 missense probably damaging 1.00
IGL03062:Slc39a8 APN 3 135886797 splice site probably benign
IGL03144:Slc39a8 APN 3 135884210 missense probably benign 0.01
IGL03329:Slc39a8 APN 3 135884713 missense probably damaging 0.98
R1449:Slc39a8 UTSW 3 135826685 missense probably benign 0.41
R2869:Slc39a8 UTSW 3 135886793 splice site probably null
R2870:Slc39a8 UTSW 3 135886793 splice site probably null
R2870:Slc39a8 UTSW 3 135886793 splice site probably null
R2871:Slc39a8 UTSW 3 135886793 splice site probably null
R2871:Slc39a8 UTSW 3 135886793 splice site probably null
R2872:Slc39a8 UTSW 3 135886793 splice site probably null
R2872:Slc39a8 UTSW 3 135886793 splice site probably null
R2873:Slc39a8 UTSW 3 135886793 splice site probably null
R2937:Slc39a8 UTSW 3 135886823 missense probably benign 0.00
R3832:Slc39a8 UTSW 3 135849133 missense probably damaging 0.96
R4669:Slc39a8 UTSW 3 135856011 missense probably benign 0.35
R5057:Slc39a8 UTSW 3 135849029 missense probably benign 0.00
R5098:Slc39a8 UTSW 3 135858157 missense probably benign 0.01
R5677:Slc39a8 UTSW 3 135884688 missense probably damaging 1.00
R6747:Slc39a8 UTSW 3 135849180 critical splice donor site probably null
R7181:Slc39a8 UTSW 3 135857538 missense possibly damaging 0.93
R7459:Slc39a8 UTSW 3 135886911 missense probably damaging 1.00
R7506:Slc39a8 UTSW 3 135884306 missense probably benign 0.03
R7589:Slc39a8 UTSW 3 135884362 missense probably damaging 0.96
X0023:Slc39a8 UTSW 3 135826544 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCATCAAGCCAGGTACATTC -3'
(R):5'- TCCCGCGTTGACGTTATAC -3'

Sequencing Primer
(F):5'- GCATCAAGCCAGGTACATTCTATCTG -3'
(R):5'- CGCGTTGACGTTATACTCCAC -3'
Posted On2014-12-04