Incidental Mutation 'R2869:Otud4'
ID253449
Institutional Source Beutler Lab
Gene Symbol Otud4
Ensembl Gene ENSMUSG00000036990
Gene NameOTU domain containing 4
Synonyms4930431L18Rik, D8Ertd69e
MMRRC Submission 040457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R2869 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location79639618-79677724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79661073 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 300 (N300K)
Ref Sequence ENSEMBL: ENSMUSP00000134097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173078] [ENSMUST00000173286]
Predicted Effect possibly damaging
Transcript: ENSMUST00000173078
AA Change: N301K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133939
Gene: ENSMUSG00000036990
AA Change: N301K

DomainStartEndE-ValueType
Pfam:OTU 40 154 3.4e-17 PFAM
low complexity region 189 213 N/A INTRINSIC
Blast:TUDOR 280 335 2e-7 BLAST
low complexity region 392 405 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1082 1104 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173286
AA Change: N300K

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134097
Gene: ENSMUSG00000036990
AA Change: N300K

DomainStartEndE-ValueType
Pfam:OTU 40 149 5.3e-21 PFAM
low complexity region 189 213 N/A INTRINSIC
Blast:TUDOR 280 334 9e-9 BLAST
low complexity region 391 404 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
low complexity region 542 554 N/A INTRINSIC
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1081 1103 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174485
Meta Mutation Damage Score 0.0986 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.4%
  • 10x: 93.9%
  • 20x: 77.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alternatively spliced transcript variants have been found for this gene. The smaller protein isoform encoded by the shorter transcript variant is found only in HIV-1 infected cells. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lzts2 C A 19: 45,024,095 S321* probably null Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Serinc2 A G 4: 130,265,212 S29P probably damaging Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Otud4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Otud4 APN 8 79672881 missense probably damaging 0.99
IGL01353:Otud4 APN 8 79665021 missense probably benign
IGL01371:Otud4 APN 8 79673761 missense probably damaging 1.00
IGL01782:Otud4 APN 8 79673011 missense possibly damaging 0.95
IGL01912:Otud4 APN 8 79673837 missense probably benign
IGL02294:Otud4 APN 8 79664977 splice site probably benign
IGL02830:Otud4 APN 8 79673301 missense probably benign 0.00
IGL03063:Otud4 APN 8 79663790 missense probably benign 0.01
IGL03077:Otud4 APN 8 79673458 missense probably damaging 0.97
R0437:Otud4 UTSW 8 79669997 missense probably benign 0.02
R1024:Otud4 UTSW 8 79664093 missense probably benign 0.01
R1118:Otud4 UTSW 8 79653351 splice site probably benign
R1296:Otud4 UTSW 8 79673974 missense unknown
R1321:Otud4 UTSW 8 79669950 missense probably benign 0.03
R1674:Otud4 UTSW 8 79673147 missense probably benign 0.12
R1736:Otud4 UTSW 8 79651665 splice site probably benign
R1815:Otud4 UTSW 8 79639989 nonsense probably null
R1950:Otud4 UTSW 8 79646332 missense probably damaging 0.99
R1985:Otud4 UTSW 8 79640012 missense probably damaging 1.00
R2173:Otud4 UTSW 8 79668464 missense probably damaging 1.00
R2869:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2870:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2870:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2872:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2872:Otud4 UTSW 8 79661073 missense possibly damaging 0.82
R2907:Otud4 UTSW 8 79673068 missense probably benign 0.02
R3545:Otud4 UTSW 8 79665055 missense probably damaging 1.00
R4628:Otud4 UTSW 8 79639968 missense possibly damaging 0.73
R4790:Otud4 UTSW 8 79666773 missense possibly damaging 0.82
R4989:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5133:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5134:Otud4 UTSW 8 79655689 missense probably damaging 1.00
R5294:Otud4 UTSW 8 79672892 missense possibly damaging 0.54
R5410:Otud4 UTSW 8 79672997 missense probably benign 0.04
R5454:Otud4 UTSW 8 79651042 missense possibly damaging 0.94
R5579:Otud4 UTSW 8 79664108 missense probably benign
R5738:Otud4 UTSW 8 79673461 missense probably benign 0.02
R5886:Otud4 UTSW 8 79672807 missense probably damaging 1.00
R6062:Otud4 UTSW 8 79673896 missense probably damaging 1.00
R6364:Otud4 UTSW 8 79646341 missense probably damaging 0.99
R6427:Otud4 UTSW 8 79668497 missense probably benign 0.00
R6450:Otud4 UTSW 8 79672997 missense probably benign 0.04
R6744:Otud4 UTSW 8 79673778 nonsense probably null
R6773:Otud4 UTSW 8 79643806 missense possibly damaging 0.95
R7046:Otud4 UTSW 8 79651042 missense possibly damaging 0.94
R7142:Otud4 UTSW 8 79672762 splice site probably null
R7420:Otud4 UTSW 8 79664108 missense probably benign 0.11
R7470:Otud4 UTSW 8 79673360 missense probably benign 0.00
R7736:Otud4 UTSW 8 79655765 missense possibly damaging 0.53
X0024:Otud4 UTSW 8 79646310 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGATAGACAGCTGCTGGTG -3'
(R):5'- TTTGCAAGTCAATTCCACCACC -3'

Sequencing Primer
(F):5'- CAGCTGCTGGTGTATGCG -3'
(R):5'- ACCACCCCTCATGATTTTTCTAAAG -3'
Posted On2014-12-04