Incidental Mutation 'R2512:Mfrp'
ID253466
Institutional Source Beutler Lab
Gene Symbol Mfrp
Ensembl Gene ENSMUSG00000034739
Gene Namemembrane frizzled-related protein
Synonyms
MMRRC Submission 040418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R2512 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44101729-44109187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44102538 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 115 (V115A)
Ref Sequence ENSEMBL: ENSMUSP00000124456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034654] [ENSMUST00000065379] [ENSMUST00000114815] [ENSMUST00000114816] [ENSMUST00000114818] [ENSMUST00000114821] [ENSMUST00000152956] [ENSMUST00000161381] [ENSMUST00000161703] [ENSMUST00000162126] [ENSMUST00000205282] [ENSMUST00000206308] [ENSMUST00000206769] [ENSMUST00000205500] [ENSMUST00000206295] [ENSMUST00000185479]
Predicted Effect probably benign
Transcript: ENSMUST00000034654
AA Change: V115A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000034654
Gene: ENSMUSG00000034739
AA Change: V115A

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 471 577 3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065379
SMART Domains Protein: ENSMUSP00000070060
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114815
SMART Domains Protein: ENSMUSP00000110463
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114816
SMART Domains Protein: ENSMUSP00000110464
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114818
SMART Domains Protein: ENSMUSP00000110466
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114821
SMART Domains Protein: ENSMUSP00000110469
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 220 1.01e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152956
SMART Domains Protein: ENSMUSP00000123040
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Collagen 28 102 7.2e-10 PFAM
Pfam:C1q 105 138 1.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160985
SMART Domains Protein: ENSMUSP00000124568
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
RING 11 52 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161381
AA Change: V115A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124456
Gene: ENSMUSG00000034739
AA Change: V115A

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 465 576 9.1e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161703
AA Change: V115A
SMART Domains Protein: ENSMUSP00000125053
Gene: ENSMUSG00000034739
AA Change: V115A

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
LDLa 307 342 2.09e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162126
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162196
Predicted Effect unknown
Transcript: ENSMUST00000205282
AA Change: S81P
Predicted Effect probably benign
Transcript: ENSMUST00000206308
AA Change: V115A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000206722
Predicted Effect probably benign
Transcript: ENSMUST00000206769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174014
Predicted Effect probably benign
Transcript: ENSMUST00000205500
Predicted Effect probably benign
Transcript: ENSMUST00000206295
Predicted Effect probably benign
Transcript: ENSMUST00000185479
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains a region with similarity to the cysteine-rich domain (CRD) of frizzled, a gene originally found in Drosophila that controls tissue polarity. This protein functions in eye development, where it is necessary for the maintenance of photoreceptor outer segments. Mutations in this gene cause retinal degeneration 6 in mice, which gives rise to a mouse model for human retinitis punctata albescens. Bicistronic transcripts composed of the coding sequences for this gene (Mfrp) and the C1q and tumor necrosis factor related protein 5 gene (C1qtnf5) have been identified, and the resulting products can interact with each other. Co-transcription of C1qtnf5 and Mfrp has been observed in both human and mouse. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mutations produce mice having small, white retinal spots and progressive photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,726 T60A probably benign Het
2700049A03Rik A G 12: 71,173,171 T831A possibly damaging Het
Actg2 T A 6: 83,526,847 I72F probably damaging Het
Add1 A G 5: 34,616,686 T80A probably benign Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Aplp2 C T 9: 31,167,677 R325H probably damaging Het
Aptx G A 4: 40,694,917 P140S probably benign Het
C87499 T G 4: 88,628,958 M246L probably damaging Het
Carm1 A G 9: 21,575,412 probably null Het
Carmil2 A T 8: 105,697,393 I1293F probably benign Het
Cdh8 T C 8: 99,400,863 T39A probably benign Het
Col15a1 T A 4: 47,245,868 N206K possibly damaging Het
Copg2 C T 6: 30,896,656 probably null Het
Ctr9 T G 7: 111,046,871 I690S probably damaging Het
Dcaf8 T G 1: 172,189,035 I463S possibly damaging Het
Dcp1b G T 6: 119,206,512 A187S possibly damaging Het
Ddo T A 10: 40,632,939 D58E possibly damaging Het
Dkkl1 G T 7: 45,207,733 R137S probably damaging Het
Dxo A G 17: 34,837,742 N115S probably benign Het
Ep400 A T 5: 110,708,915 probably benign Het
F11 A G 8: 45,261,061 V7A probably benign Het
Fermt1 G T 2: 132,939,518 probably null Het
Fign A T 2: 63,979,799 F376I probably benign Het
Flg2 G T 3: 93,201,775 G370V probably damaging Het
Fndc3a A T 14: 72,556,275 D953E probably benign Het
Fsip2 A T 2: 82,978,167 H1610L probably benign Het
Gfra3 T C 18: 34,704,511 N145D probably benign Het
Inpp4b G T 8: 82,010,550 W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lgi2 A G 5: 52,537,965 *543R probably null Het
Lyn A G 4: 3,745,542 T114A probably benign Het
Lynx1 A G 15: 74,751,320 Y88H probably damaging Het
Map4 C A 9: 110,034,702 P332T possibly damaging Het
Mapk8ip3 A T 17: 24,914,703 C250* probably null Het
Metap1d A G 2: 71,522,610 H261R probably damaging Het
Mtbp A G 15: 55,577,536 Y373C probably damaging Het
Mtor C A 4: 148,530,491 R1628S possibly damaging Het
Muc5b A G 7: 141,859,076 N1920D unknown Het
Myo1d T A 11: 80,779,717 M26L probably benign Het
Neb A C 2: 52,210,831 D643E probably damaging Het
Nme1 A G 11: 93,960,687 F108L possibly damaging Het
Olfr458 A G 6: 42,460,273 S249P probably damaging Het
Olfr893 G T 9: 38,209,374 C54F probably damaging Het
Pan2 T A 10: 128,304,457 D82E probably damaging Het
Pclo A G 5: 14,712,598 D3695G unknown Het
Pcnx4 A T 12: 72,556,799 probably null Het
Plg A G 17: 12,403,229 T479A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptgis T C 2: 167,207,276 D372G probably damaging Het
Ranbp3l A G 15: 8,968,465 T14A probably benign Het
Rcc1l A T 5: 134,166,669 V230D probably damaging Het
Reln T C 5: 21,979,690 D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr1 G A 7: 29,103,542 L696F possibly damaging Het
Sacs T A 14: 61,203,080 D858E probably benign Het
Sec16a C T 2: 26,439,025 V993I probably benign Het
Skint5 T A 4: 113,630,419 I901F unknown Het
Slc17a3 A T 13: 23,846,247 I114F probably benign Het
Slc17a7 T A 7: 45,168,864 L71Q probably damaging Het
Slc43a2 T C 11: 75,570,577 S452P probably damaging Het
Smarca4 A G 9: 21,635,698 N173S possibly damaging Het
Tbc1d21 T C 9: 58,362,912 Y161C probably damaging Het
Tpsab1 C A 17: 25,345,107 C94F probably damaging Het
Ubr5 G A 15: 38,002,319 P1496L probably damaging Het
Unc80 G T 1: 66,671,608 A2679S possibly damaging Het
Vdac1 T A 11: 52,384,077 V184E probably damaging Het
Vmn2r24 T A 6: 123,787,026 S287R probably benign Het
Vmn2r91 T C 17: 18,135,786 F572L probably benign Het
Vps13b G A 15: 35,884,555 E3125K probably benign Het
Ythdf3 A G 3: 16,204,895 N406S possibly damaging Het
Zfp708 T C 13: 67,071,187 K158E probably damaging Het
Other mutations in Mfrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Mfrp APN 9 44104689 missense probably benign 0.39
IGL02077:Mfrp APN 9 44105220 missense probably damaging 1.00
IGL02313:Mfrp APN 9 44102874 missense probably damaging 1.00
IGL02544:Mfrp APN 9 44102794 missense probably damaging 1.00
IGL02709:Mfrp APN 9 44103264 missense probably benign 0.00
R1592:Mfrp UTSW 9 44103222 missense probably damaging 1.00
R1728:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1729:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1886:Mfrp UTSW 9 44103488 missense possibly damaging 0.94
R1974:Mfrp UTSW 9 44106372 missense probably damaging 1.00
R2146:Mfrp UTSW 9 44103718 missense probably benign 0.12
R2150:Mfrp UTSW 9 44103718 missense probably benign 0.12
R3788:Mfrp UTSW 9 44105457 nonsense probably null
R4204:Mfrp UTSW 9 44105228 missense possibly damaging 0.86
R4240:Mfrp UTSW 9 44102866 missense possibly damaging 0.91
R4839:Mfrp UTSW 9 44102135 missense possibly damaging 0.89
R4963:Mfrp UTSW 9 44103264 missense probably benign 0.33
R5041:Mfrp UTSW 9 44102278 missense probably damaging 1.00
R6370:Mfrp UTSW 9 44106261 missense probably damaging 1.00
R7420:Mfrp UTSW 9 44102476 unclassified probably benign
R7454:Mfrp UTSW 9 44105183 missense possibly damaging 0.90
Z1177:Mfrp UTSW 9 44102519 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGGGAGGGCTTTACATGG -3'
(R):5'- CTGAAGAAACCACTGGGACC -3'

Sequencing Primer
(F):5'- GAGATCCCATGAGCTATTCTGTCAG -3'
(R):5'- TCAACAGGAGAGAGGTCTTCCC -3'
Posted On2014-12-04