Incidental Mutation 'R0313:Xylt2'
ID25348
Institutional Source Beutler Lab
Gene Symbol Xylt2
Ensembl Gene ENSMUSG00000020868
Gene Namexylosyltransferase II
SynonymsE030002B02Rik
MMRRC Submission 038523-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R0313 (G1)
Quality Score212
Status Validated
Chromosome11
Chromosomal Location94663851-94677515 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 94669894 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116349] [ENSMUST00000146693] [ENSMUST00000150377] [ENSMUST00000153485]
Predicted Effect probably benign
Transcript: ENSMUST00000116349
SMART Domains Protein: ENSMUSP00000112052
Gene: ENSMUSG00000020868

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Branch 234 489 1.9e-60 PFAM
Pfam:Xylo_C 519 699 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146693
Predicted Effect probably benign
Transcript: ENSMUST00000150377
SMART Domains Protein: ENSMUSP00000134495
Gene: ENSMUSG00000020868

DomainStartEndE-ValueType
Pfam:Xylo_C 31 97 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153485
SMART Domains Protein: ENSMUSP00000122581
Gene: ENSMUSG00000020868

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Branch 234 489 1.1e-59 PFAM
Pfam:Xylo_C 519 594 2.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154830
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.9%
  • 20x: 88.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isoform of xylosyltransferase, which belongs to a family of glycosyltransferases. This enzyme transfers xylose from UDP-xylose to specific serine residues of the core protein and initiates the biosynthesis of glycosaminoglycan chains in proteoglycans including chondroitin sulfate, heparan sulfate, heparin and dermatan sulfate. The enzyme activity, which is increased in scleroderma patients, is a diagnostic marker for the determination of sclerotic activity in systemic sclerosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele lack most liver proteoglycans and develop many aspects of polycystic liver and kidney disease, including biliary tract hyperplasia, liver fibrosis, biliary cysts, renal tubule dilation, basement membrane abnormalities and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 A G 6: 58,672,097 E309G probably benign Het
AI314180 A G 4: 58,811,892 I1411T probably benign Het
Ankmy1 C T 1: 92,886,221 G412D probably damaging Het
Cc2d1a G A 8: 84,136,969 T542I probably benign Het
Cldn18 T C 9: 99,698,914 I94V probably benign Het
Cobll1 G A 2: 65,095,744 R1195* probably null Het
Dnah7b A G 1: 46,207,643 T1660A probably damaging Het
Dzip3 G T 16: 48,937,061 Q870K probably damaging Het
Ebf4 T C 2: 130,306,787 probably benign Het
Esyt2 T C 12: 116,347,808 L439P probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Haspin A G 11: 73,136,298 V655A probably damaging Het
Kmt2c T C 5: 25,344,930 E1351G probably damaging Het
Lama2 C A 10: 26,993,398 probably null Het
Lcp1 A G 14: 75,199,433 E73G probably damaging Het
Ltv1 C T 10: 13,182,860 probably null Het
Mcmdc2 A G 1: 9,932,141 Y529C probably damaging Het
Myo3b T A 2: 70,348,959 Y1172* probably null Het
Ncf1 T C 5: 134,229,567 M1V probably null Het
Olfr1297 C T 2: 111,621,600 S158N possibly damaging Het
Olfr250 T C 9: 38,368,304 S243P probably damaging Het
Olfr765 A G 10: 129,046,826 V79A possibly damaging Het
Pcif1 A T 2: 164,884,419 H80L probably damaging Het
Pclo T C 5: 14,678,873 probably benign Het
Polr2a T C 11: 69,735,080 Y1710C unknown Het
Ppp1r37 G A 7: 19,533,998 T324I probably damaging Het
Prmt1 T C 7: 44,978,748 D176G probably benign Het
Scn5a T C 9: 119,534,571 D501G probably damaging Het
Ska2 A G 11: 87,117,814 I89M possibly damaging Het
Slc39a7 G A 17: 34,029,544 A375V probably damaging Het
Ssrp1 T A 2: 85,041,554 I374N probably damaging Het
Stox2 C T 8: 47,192,134 G828R probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Uqcrc1 C A 9: 108,948,574 R114S possibly damaging Het
Usp38 A T 8: 80,984,442 L988* probably null Het
Vmn2r5 T A 3: 64,503,827 H440L probably benign Het
Wdr12 A T 1: 60,082,579 I271N possibly damaging Het
Other mutations in Xylt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02048:Xylt2 APN 11 94666345 missense possibly damaging 0.61
IGL02421:Xylt2 APN 11 94667762 missense possibly damaging 0.45
P0040:Xylt2 UTSW 11 94668791 missense possibly damaging 0.46
PIT4585001:Xylt2 UTSW 11 94666240 missense probably damaging 1.00
R0016:Xylt2 UTSW 11 94669640 missense probably damaging 1.00
R0016:Xylt2 UTSW 11 94669640 missense probably damaging 1.00
R0449:Xylt2 UTSW 11 94666333 missense probably benign 0.22
R0511:Xylt2 UTSW 11 94669936 nonsense probably null
R1483:Xylt2 UTSW 11 94669567 missense probably benign 0.04
R1511:Xylt2 UTSW 11 94670433 missense probably damaging 1.00
R1565:Xylt2 UTSW 11 94667594 missense probably benign
R1616:Xylt2 UTSW 11 94668209 missense probably damaging 1.00
R1702:Xylt2 UTSW 11 94668745 missense probably damaging 0.98
R1712:Xylt2 UTSW 11 94668749 missense possibly damaging 0.88
R2233:Xylt2 UTSW 11 94669996 missense possibly damaging 0.71
R2234:Xylt2 UTSW 11 94669996 missense possibly damaging 0.71
R4534:Xylt2 UTSW 11 94666350 missense probably benign 0.02
R4702:Xylt2 UTSW 11 94669529 missense possibly damaging 0.83
R4768:Xylt2 UTSW 11 94670472 missense probably benign 0.06
R5032:Xylt2 UTSW 11 94670016 missense probably damaging 0.99
R5237:Xylt2 UTSW 11 94667127 missense probably benign
R5281:Xylt2 UTSW 11 94668790 missense probably benign 0.30
R5949:Xylt2 UTSW 11 94668483 missense probably damaging 1.00
R6950:Xylt2 UTSW 11 94667629 missense probably benign
R7041:Xylt2 UTSW 11 94667582 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGTGTCACCCGCACATTCTC -3'
(R):5'- GCAAGCAGGCAGCCTTTTCTTC -3'

Sequencing Primer
(F):5'- AGCTGGGCACCACAGTTATTG -3'
(R):5'- TTTCCACGCAGGCAAGATG -3'
Posted On2013-04-16