Incidental Mutation 'R2512:Myo1d'
ID253483
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Namemyosin ID
Synonyms9930104H07Rik, D11Ertd9e
MMRRC Submission 040418-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2512 (G1)
Quality Score217
Status Not validated
Chromosome11
Chromosomal Location80482126-80780025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80779717 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 26 (M26L)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
Predicted Effect probably benign
Transcript: ENSMUST00000041065
AA Change: M26L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: M26L

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070997
AA Change: M26L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: M26L

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125944
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,726 T60A probably benign Het
2700049A03Rik A G 12: 71,173,171 T831A possibly damaging Het
Actg2 T A 6: 83,526,847 I72F probably damaging Het
Add1 A G 5: 34,616,686 T80A probably benign Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Aplp2 C T 9: 31,167,677 R325H probably damaging Het
Aptx G A 4: 40,694,917 P140S probably benign Het
C87499 T G 4: 88,628,958 M246L probably damaging Het
Carm1 A G 9: 21,575,412 probably null Het
Carmil2 A T 8: 105,697,393 I1293F probably benign Het
Cdh8 T C 8: 99,400,863 T39A probably benign Het
Col15a1 T A 4: 47,245,868 N206K possibly damaging Het
Copg2 C T 6: 30,896,656 probably null Het
Ctr9 T G 7: 111,046,871 I690S probably damaging Het
Dcaf8 T G 1: 172,189,035 I463S possibly damaging Het
Dcp1b G T 6: 119,206,512 A187S possibly damaging Het
Ddo T A 10: 40,632,939 D58E possibly damaging Het
Dkkl1 G T 7: 45,207,733 R137S probably damaging Het
Dxo A G 17: 34,837,742 N115S probably benign Het
Ep400 A T 5: 110,708,915 probably benign Het
F11 A G 8: 45,261,061 V7A probably benign Het
Fermt1 G T 2: 132,939,518 probably null Het
Fign A T 2: 63,979,799 F376I probably benign Het
Flg2 G T 3: 93,201,775 G370V probably damaging Het
Fndc3a A T 14: 72,556,275 D953E probably benign Het
Fsip2 A T 2: 82,978,167 H1610L probably benign Het
Gfra3 T C 18: 34,704,511 N145D probably benign Het
Inpp4b G T 8: 82,010,550 W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lgi2 A G 5: 52,537,965 *543R probably null Het
Lyn A G 4: 3,745,542 T114A probably benign Het
Lynx1 A G 15: 74,751,320 Y88H probably damaging Het
Map4 C A 9: 110,034,702 P332T possibly damaging Het
Mapk8ip3 A T 17: 24,914,703 C250* probably null Het
Metap1d A G 2: 71,522,610 H261R probably damaging Het
Mfrp T C 9: 44,102,538 V115A probably benign Het
Mtbp A G 15: 55,577,536 Y373C probably damaging Het
Mtor C A 4: 148,530,491 R1628S possibly damaging Het
Muc5b A G 7: 141,859,076 N1920D unknown Het
Neb A C 2: 52,210,831 D643E probably damaging Het
Nme1 A G 11: 93,960,687 F108L possibly damaging Het
Olfr458 A G 6: 42,460,273 S249P probably damaging Het
Olfr893 G T 9: 38,209,374 C54F probably damaging Het
Pan2 T A 10: 128,304,457 D82E probably damaging Het
Pclo A G 5: 14,712,598 D3695G unknown Het
Pcnx4 A T 12: 72,556,799 probably null Het
Plg A G 17: 12,403,229 T479A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptgis T C 2: 167,207,276 D372G probably damaging Het
Ranbp3l A G 15: 8,968,465 T14A probably benign Het
Rcc1l A T 5: 134,166,669 V230D probably damaging Het
Reln T C 5: 21,979,690 D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr1 G A 7: 29,103,542 L696F possibly damaging Het
Sacs T A 14: 61,203,080 D858E probably benign Het
Sec16a C T 2: 26,439,025 V993I probably benign Het
Skint5 T A 4: 113,630,419 I901F unknown Het
Slc17a3 A T 13: 23,846,247 I114F probably benign Het
Slc17a7 T A 7: 45,168,864 L71Q probably damaging Het
Slc43a2 T C 11: 75,570,577 S452P probably damaging Het
Smarca4 A G 9: 21,635,698 N173S possibly damaging Het
Tbc1d21 T C 9: 58,362,912 Y161C probably damaging Het
Tpsab1 C A 17: 25,345,107 C94F probably damaging Het
Ubr5 G A 15: 38,002,319 P1496L probably damaging Het
Unc80 G T 1: 66,671,608 A2679S possibly damaging Het
Vdac1 T A 11: 52,384,077 V184E probably damaging Het
Vmn2r24 T A 6: 123,787,026 S287R probably benign Het
Vmn2r91 T C 17: 18,135,786 F572L probably benign Het
Vps13b G A 15: 35,884,555 E3125K probably benign Het
Ythdf3 A G 3: 16,204,895 N406S possibly damaging Het
Zfp708 T C 13: 67,071,187 K158E probably damaging Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7077:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R8324:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R8329:Myo1d UTSW 11 80638074 missense probably benign 0.21
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGACCTCATCACACCCTGGAG -3'
(R):5'- ATGCCCGTGCCTGTCTTTAG -3'

Sequencing Primer
(F):5'- GCCGCACCAAGGAAGAGTC -3'
(R):5'- AGCTCTGAGGAGTGGCG -3'
Posted On2014-12-04