Incidental Mutation 'R2869:Ch25h'
ID253493
Institutional Source Beutler Lab
Gene Symbol Ch25h
Ensembl Gene ENSMUSG00000050370
Gene Namecholesterol 25-hydroxylase
Synonymsm25OH
MMRRC Submission 040457-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R2869 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34473786-34475135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34474810 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 106 (H106L)
Ref Sequence ENSEMBL: ENSMUSP00000049683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050562]
Predicted Effect probably benign
Transcript: ENSMUST00000050562
AA Change: H106L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000049683
Gene: ENSMUSG00000050370
AA Change: H106L

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
Pfam:FA_hydroxylase 128 263 3.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181777
Meta Mutation Damage Score 0.0649 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.4%
  • 10x: 93.9%
  • 20x: 77.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This is an intronless gene that is involved in cholesterol and lipid metabolism. The encoded protein is a membrane protein and contains clusters of histidine residues essential for catalytic activity. Unlike most other sterol hydroxylases, this enzyme is a member of a small family of enzymes that utilize diiron cofactors to catalyze the hydroxylation of hydrophobic substrates. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased IgG2a and IgA in the sera, lungs, and intestinal mucosa and increased IgG2b and IgG3 in the intestinal mucosa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Lzts2 C A 19: 45,024,095 S321* probably null Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Serinc2 A G 4: 130,265,212 S29P probably damaging Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Ch25h
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0738:Ch25h UTSW 19 34474387 missense possibly damaging 0.90
R1711:Ch25h UTSW 19 34474286 missense probably benign
R2177:Ch25h UTSW 19 34474697 missense probably damaging 1.00
R2873:Ch25h UTSW 19 34474810 missense probably benign 0.03
R5558:Ch25h UTSW 19 34474463 missense probably damaging 1.00
R6173:Ch25h UTSW 19 34474496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCCAGAAGCTCATGTATTGG -3'
(R):5'- ATCACTTACGTGGGCTTCTGC -3'

Sequencing Primer
(F):5'- CAGAAGCTCATGTATTGGGTCGC -3'
(R):5'- CTGCCTACCGTTCGTGGTG -3'
Posted On2014-12-04