Incidental Mutation 'R2869:Lzts2'
ID253494
Institutional Source Beutler Lab
Gene Symbol Lzts2
Ensembl Gene ENSMUSG00000035342
Gene Nameleucine zipper, putative tumor suppressor 2
Synonyms
MMRRC Submission 040457-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R2869 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location45015176-45027104 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 45024095 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 321 (S321*)
Ref Sequence ENSEMBL: ENSMUSP00000137571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039016] [ENSMUST00000145391] [ENSMUST00000169459] [ENSMUST00000178087] [ENSMUST00000179108]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038901
Predicted Effect probably null
Transcript: ENSMUST00000039016
AA Change: S321*
SMART Domains Protein: ENSMUSP00000045478
Gene: ENSMUSG00000035342
AA Change: S321*

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 639 4.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145391
SMART Domains Protein: ENSMUSP00000119002
Gene: ENSMUSG00000074818

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169459
SMART Domains Protein: ENSMUSP00000133273
Gene: ENSMUSG00000074818

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178087
AA Change: S321*
SMART Domains Protein: ENSMUSP00000136405
Gene: ENSMUSG00000035342
AA Change: S321*

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 638 2.2e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179108
AA Change: S321*
SMART Domains Protein: ENSMUSP00000137571
Gene: ENSMUSG00000035342
AA Change: S321*

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 639 4.2e-82 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.4%
  • 10x: 93.9%
  • 20x: 77.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leucine zipper tumor suppressor family of proteins, which function in transcription regulation and cell cycle control. This family member can repress beta-catenin-mediated transcriptional activation and is a negative regulator of the Wnt signaling pathway. It negatively regulates microtubule severing at centrosomes, and is necessary for central spindle formation and cytokinesis completion. It is implicated in cancer, where it may inhibit cell proliferation and decrease susceptibility to tumor development. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation display defects in urinary tract development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ccl27a C T 4: 41,769,640 R73Q probably benign Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Ch25h T A 19: 34,474,810 H106L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Ggt6 A T 11: 72,437,361 N229I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gsdme A T 6: 50,208,177 C432* probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Kcnb1 A G 2: 167,105,935 L331P probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Krt13 A G 11: 100,117,649 S421P unknown Het
Lactbl1 G A 4: 136,626,786 C37Y probably damaging Het
Meikin T C 11: 54,373,507 V103A possibly damaging Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nbn T A 4: 15,963,810 D70E probably damaging Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nwd2 A T 5: 63,800,328 I334L probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr730 T C 14: 50,186,354 T288A probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Serinc2 A G 4: 130,265,212 S29P probably damaging Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
St7 C T 6: 17,819,277 P60L probably damaging Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tnni3k C T 3: 154,938,750 probably null Het
Tprg T C 16: 25,412,840 W189R probably damaging Het
Trim32 A G 4: 65,614,457 D417G probably damaging Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Lzts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Lzts2 APN 19 45026370 unclassified probably benign
R0053:Lzts2 UTSW 19 45026307 unclassified probably benign
R0135:Lzts2 UTSW 19 45026187 unclassified probably benign
R0433:Lzts2 UTSW 19 45021676 missense possibly damaging 0.87
R1079:Lzts2 UTSW 19 45023544 missense probably damaging 1.00
R1459:Lzts2 UTSW 19 45021454 missense probably damaging 1.00
R2869:Lzts2 UTSW 19 45024095 nonsense probably null
R4450:Lzts2 UTSW 19 45023593 nonsense probably null
R5806:Lzts2 UTSW 19 45026367 unclassified probably benign
R6958:Lzts2 UTSW 19 45024143 unclassified probably benign
R7598:Lzts2 UTSW 19 45023833 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATCCAGCTTGCCCACCTACAG -3'
(R):5'- GTCACACCAGGAGTCTTGAC -3'

Sequencing Primer
(F):5'- TTGCCCACCTACAGCACTGG -3'
(R):5'- ACCAGGAGTCTTGACCCTCTC -3'
Posted On2014-12-04