Mutagenetix > Incidental Mutation

Incidental Mutation 'R0313:Lcp1'

25351

Institutional Source

Beutler Lab

Gene Symbol

Lcp1

Ensembl Gene

ENSMUSG00000021998

Gene Name

lymphocyte cytosolic protein 1

Synonyms

D14Ertd310e, L-fimbrin, Pls2, L-plastin

MMRRC Submission

038523-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0313 (G1)

Quality Score

175

Status

Validated

Chromosome

Chromosomal Location

75131101-75230842 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75199433 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 73 (E73G)

Ref Sequence

ENSEMBL: ENSMUSP00000118721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122840] [ENSMUST00000124499] [ENSMUST00000125833] [ENSMUST00000131802] [ENSMUST00000134114] [ENSMUST00000143539] [ENSMUST00000145303]

AlphaFold

Q61233

Predicted Effect

probably benign
Transcript: ENSMUST00000122840
AA Change: E73G

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000117984
Gene: ENSMUSG00000021998
AA Change: E73G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124499
AA Change: E73G

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: E73G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125833
AA Change: E73G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000116033
Gene: ENSMUSG00000021998
AA Change: E73G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130510

Predicted Effect

probably benign
Transcript: ENSMUST00000131802
AA Change: E73G

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: E73G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000134114
AA Change: E73G

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000121376
Gene: ENSMUSG00000021998
AA Change: E73G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000143539
AA Change: E73G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118721
Gene: ENSMUSG00000021998
AA Change: E73G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	76	4.45e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145303
AA Change: E73G

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: E73G

Domain	Start	End	E-Value	Type
EFh	13	41	6.91e-5	SMART
EFh	53	81	7.7e-3	SMART
CH	122	234	1.15e-24	SMART
CH	266	373	1.51e-19	SMART
CH	396	501	1.87e-24	SMART
CH	517	622	8.55e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161819

Meta Mutation Damage Score

0.3058

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.9%
20x: 88.5%

Validation Efficiency

98% (40/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg2	A	G	6: 58,672,097	E309G	probably benign	Het
AI314180	A	G	4: 58,811,892	I1411T	probably benign	Het
Ankmy1	C	T	1: 92,886,221	G412D	probably damaging	Het
Cc2d1a	G	A	8: 84,136,969	T542I	probably benign	Het
Cldn18	T	C	9: 99,698,914	I94V	probably benign	Het
Cobll1	G	A	2: 65,095,744	R1195*	probably null	Het
Dnah7b	A	G	1: 46,207,643	T1660A	probably damaging	Het
Dzip3	G	T	16: 48,937,061	Q870K	probably damaging	Het
Ebf4	T	C	2: 130,306,787		probably benign	Het
Esyt2	T	C	12: 116,347,808	L439P	probably damaging	Het
Fbxl17	G	A	17: 63,356,851	R67C	probably damaging	Het
Haspin	A	G	11: 73,136,298	V655A	probably damaging	Het
Kmt2c	T	C	5: 25,344,930	E1351G	probably damaging	Het
Lama2	C	A	10: 26,993,398		probably null	Het
Ltv1	C	T	10: 13,182,860		probably null	Het
Mcmdc2	A	G	1: 9,932,141	Y529C	probably damaging	Het
Myo3b	T	A	2: 70,348,959	Y1172*	probably null	Het
Ncf1	T	C	5: 134,229,567	M1V	probably null	Het
Olfr1297	C	T	2: 111,621,600	S158N	possibly damaging	Het
Olfr250	T	C	9: 38,368,304	S243P	probably damaging	Het
Olfr765	A	G	10: 129,046,826	V79A	possibly damaging	Het
Pcif1	A	T	2: 164,884,419	H80L	probably damaging	Het
Pclo	T	C	5: 14,678,873		probably benign	Het
Polr2a	T	C	11: 69,735,080	Y1710C	unknown	Het
Ppp1r37	G	A	7: 19,533,998	T324I	probably damaging	Het
Prmt1	T	C	7: 44,978,748	D176G	probably benign	Het
Scn5a	T	C	9: 119,534,571	D501G	probably damaging	Het
Ska2	A	G	11: 87,117,814	I89M	possibly damaging	Het
Slc39a7	G	A	17: 34,029,544	A375V	probably damaging	Het
Ssrp1	T	A	2: 85,041,554	I374N	probably damaging	Het
Stox2	C	T	8: 47,192,134	G828R	probably damaging	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Uqcrc1	C	A	9: 108,948,574	R114S	possibly damaging	Het
Usp38	A	T	8: 80,984,442	L988*	probably null	Het
Vmn2r5	T	A	3: 64,503,827	H440L	probably benign	Het
Wdr12	A	T	1: 60,082,579	I271N	possibly damaging	Het
Xylt2	C	T	11: 94,669,894		probably benign	Het

Other mutations in Lcp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Lcp1	APN	14	75227093	critical splice donor site	probably null
IGL01768:Lcp1	APN	14	75224133	missense	probably benign	0.40
IGL01801:Lcp1	APN	14	75199375	missense	probably benign	0.10
IGL01940:Lcp1	APN	14	75216365	missense	probably benign	0.17
IGL02135:Lcp1	APN	14	75200486	missense	probably benign	0.00
IGL02185:Lcp1	APN	14	75229300	missense	possibly damaging	0.73
IGL02478:Lcp1	APN	14	75224096	missense	probably benign	0.04
IGL02604:Lcp1	APN	14	75224126	missense	probably benign	0.11
R0244:Lcp1	UTSW	14	75227001	missense	possibly damaging	0.92
R0295:Lcp1	UTSW	14	75199420	missense	probably null	0.59
R0415:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
R0751:Lcp1	UTSW	14	75199387	missense	probably benign	0.00
R0811:Lcp1	UTSW	14	75214488	missense	probably benign	0.00
R0812:Lcp1	UTSW	14	75214488	missense	probably benign	0.00
R1200:Lcp1	UTSW	14	75229302	missense	possibly damaging	0.73
R1713:Lcp1	UTSW	14	75199444	critical splice donor site	probably null
R1915:Lcp1	UTSW	14	75199297	missense	possibly damaging	0.81
R1969:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1970:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R1971:Lcp1	UTSW	14	75200506	missense	probably damaging	1.00
R2045:Lcp1	UTSW	14	75200401	missense	probably benign	0.01
R2064:Lcp1	UTSW	14	75198075	critical splice acceptor site	probably null
R3949:Lcp1	UTSW	14	75206129	missense	possibly damaging	0.68
R4062:Lcp1	UTSW	14	75215180	missense	probably damaging	1.00
R4521:Lcp1	UTSW	14	75215168	missense	possibly damaging	0.94
R4811:Lcp1	UTSW	14	75200408	missense	probably damaging	0.99
R4854:Lcp1	UTSW	14	75200489	missense	probably damaging	1.00
R4974:Lcp1	UTSW	14	75208471	nonsense	probably null
R5539:Lcp1	UTSW	14	75229298	missense	probably benign	0.08
R5561:Lcp1	UTSW	14	75212508	missense	probably benign	0.01
R5724:Lcp1	UTSW	14	75226982	missense	probably benign	0.18
R5989:Lcp1	UTSW	14	75199387	missense	probably benign	0.00
R6731:Lcp1	UTSW	14	75206189	missense	probably damaging	1.00
R7346:Lcp1	UTSW	14	75210506	missense	possibly damaging	0.49
R7670:Lcp1	UTSW	14	75200431	missense	probably benign	0.12
R7698:Lcp1	UTSW	14	75206211	nonsense	probably null
R9780:Lcp1	UTSW	14	75202738	missense	probably damaging	1.00
S24628:Lcp1	UTSW	14	75227006	missense	possibly damaging	0.88
X0027:Lcp1	UTSW	14	75227086	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACAGATACCGATGGCAACGGATAC -3'
(R):5'- TGCCTTAGGTTCCCAAGGGCAG -3'

Sequencing Primer
(F):5'- TGGCAACGGATACATCAGC -3'
(R):5'- tgaacctctgaaactgtaagcc -3'

Posted On

2013-04-16