Incidental Mutation 'R2513:Eif2ak4'
ID253552
Institutional Source Beutler Lab
Gene Symbol Eif2ak4
Ensembl Gene ENSMUSG00000005102
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 4
SynonymsGCN2
MMRRC Submission 040419-MU
Accession Numbers

MGI: 1353427

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2513 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118388618-118475234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118426583 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 402 (D402E)
Ref Sequence ENSEMBL: ENSMUSP00000106496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110870] [ENSMUST00000110872] [ENSMUST00000110874] [ENSMUST00000110877]
Predicted Effect probably damaging
Transcript: ENSMUST00000005233
AA Change: D523E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: D523E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 4.6e-27 PFAM
Pfam:Pkinase_Tyr 326 535 5.5e-18 PFAM
Pfam:Pkinase 589 663 1.7e-11 PFAM
Pfam:Pkinase_Tyr 589 663 1.2e-5 PFAM
low complexity region 728 738 N/A INTRINSIC
Pfam:Pkinase 781 1000 2.6e-38 PFAM
Pfam:Pkinase_Tyr 786 998 1.8e-18 PFAM
Pfam:tRNA-synt_His 1054 1380 5.7e-18 PFAM
Pfam:HGTP_anticodon2 1392 1647 5.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102527
AA Change: D411E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102
AA Change: D411E

DomainStartEndE-ValueType
coiled coil region 34 93 N/A INTRINSIC
Pfam:Pkinase 211 426 1.6e-22 PFAM
Pfam:Pkinase_Tyr 215 423 6.8e-18 PFAM
Pfam:Pkinase_Tyr 477 551 1.2e-5 PFAM
Pfam:Pkinase 477 552 3.9e-11 PFAM
low complexity region 616 626 N/A INTRINSIC
Pfam:Pkinase 647 888 9.4e-42 PFAM
Pfam:Pkinase_Tyr 672 886 1.4e-19 PFAM
Pfam:tRNA-synt_His 941 1268 4.8e-19 PFAM
Pfam:HGTP_anticodon2 1280 1535 1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110870
AA Change: D245E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106494
Gene: ENSMUSG00000005102
AA Change: D245E

DomainStartEndE-ValueType
Pfam:Pkinase 45 260 3.3e-22 PFAM
Pfam:Pkinase_Tyr 47 257 1.3e-17 PFAM
Pfam:Pkinase_Tyr 311 385 2.5e-5 PFAM
Pfam:Pkinase 311 386 8e-11 PFAM
low complexity region 450 460 N/A INTRINSIC
Pfam:Pkinase 481 722 1.9e-41 PFAM
Pfam:Pkinase_Tyr 506 720 2.8e-19 PFAM
Pfam:tRNA-synt_His 775 1102 8.7e-19 PFAM
Pfam:HGTP_anticodon2 1114 1369 1.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110872
AA Change: D402E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102
AA Change: D402E

DomainStartEndE-ValueType
coiled coil region 25 84 N/A INTRINSIC
Pfam:Pkinase 202 417 3.8e-22 PFAM
Pfam:Pkinase_Tyr 206 414 1.6e-17 PFAM
Pfam:Pkinase_Tyr 468 542 2.8e-5 PFAM
Pfam:Pkinase 468 543 9.1e-11 PFAM
low complexity region 607 617 N/A INTRINSIC
Pfam:Pkinase 638 879 2.2e-41 PFAM
Pfam:Pkinase_Tyr 663 877 3.3e-19 PFAM
Pfam:tRNA-synt_His 932 1259 1.1e-18 PFAM
Pfam:HGTP_anticodon2 1271 1526 2.2e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110874
AA Change: D445E

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102
AA Change: D445E

DomainStartEndE-ValueType
Pfam:RWD 8 56 6.4e-8 PFAM
coiled coil region 68 127 N/A INTRINSIC
Pfam:Pkinase 245 460 1.1e-22 PFAM
Pfam:Pkinase_Tyr 247 457 4.2e-18 PFAM
Pfam:Pkinase_Tyr 511 585 7.8e-6 PFAM
Pfam:Pkinase 511 586 2.5e-11 PFAM
low complexity region 650 660 N/A INTRINSIC
Pfam:Pkinase 681 922 6.2e-42 PFAM
Pfam:Pkinase_Tyr 706 920 9.3e-20 PFAM
Pfam:tRNA-synt_His 975 1302 3.8e-19 PFAM
Pfam:HGTP_anticodon2 1314 1569 5.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110877
AA Change: D523E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106501
Gene: ENSMUSG00000005102
AA Change: D523E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 2.6e-23 PFAM
Pfam:Pkinase_Tyr 327 535 1.1e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)
 

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,661,852 T719A possibly damaging Het
9530053A07Rik C G 7: 28,131,635 S91C probably damaging Het
Abcc1 A G 16: 14,473,009 probably null Het
Aftph C T 11: 20,708,676 probably null Het
Als2 C A 1: 59,215,117 K360N probably benign Het
Atg2a T A 19: 6,258,046 probably null Het
Axl T C 7: 25,787,516 D22G probably benign Het
Baiap2 G A 11: 119,999,226 A438T probably benign Het
Bean1 G C 8: 104,182,011 A7P probably benign Het
Birc6 C G 17: 74,647,729 P3431R probably damaging Het
Camk1d A G 2: 5,714,236 M1T probably null Het
Carmil3 T C 14: 55,503,838 Y1027H probably damaging Het
Ccdc6 G A 10: 70,187,828 probably benign Het
Cemip C A 7: 83,942,025 V1280L probably benign Het
Cfap58 C A 19: 47,962,542 N447K probably benign Het
Chd3 A G 11: 69,360,645 L520P probably damaging Het
Col1a2 T A 6: 4,531,223 probably null Het
Cpne7 A C 8: 123,117,667 probably null Het
Ctla4 T C 1: 60,912,564 V84A probably damaging Het
Dap3 A G 3: 88,928,258 V263A probably benign Het
Dhx57 T A 17: 80,241,949 probably null Het
Dlg5 C A 14: 24,164,525 K663N probably damaging Het
Dsg3 C A 18: 20,523,662 F196L possibly damaging Het
Fam208b G T 13: 3,582,150 L784I possibly damaging Het
Fance T C 17: 28,318,094 V24A probably benign Het
Fasn A T 11: 120,814,748 L1149Q probably damaging Het
Flg T A 3: 93,279,786 S182T possibly damaging Het
Gm128 T A 3: 95,239,982 S334C possibly damaging Het
Gm3727 A C 14: 7,264,561 H31Q probably damaging Het
Gm4841 T G 18: 60,270,905 T39P probably damaging Het
Golgb1 G T 16: 36,915,151 V1587L possibly damaging Het
Golm1 G A 13: 59,642,258 P243S probably benign Het
Gstcd C A 3: 133,082,320 A206S possibly damaging Het
Gstcd C A 3: 133,082,321 K205N possibly damaging Het
Gtf3c1 A G 7: 125,681,173 V355A probably benign Het
Hhatl T C 9: 121,789,170 D173G probably benign Het
Kcnu1 T A 8: 25,905,966 C660S probably benign Het
Kctd8 T C 5: 69,110,645 D374G probably benign Het
Kif21a T C 15: 90,994,391 I229V possibly damaging Het
L3mbtl1 A T 2: 162,967,585 I702F probably benign Het
Lce1d T C 3: 92,685,759 probably benign Het
Lrig1 C T 6: 94,617,366 probably null Het
Lrp12 A T 15: 39,876,111 D563E probably damaging Het
Lrp2 C T 2: 69,506,374 probably null Het
Map3k5 G A 10: 20,094,455 V703I possibly damaging Het
Mecr A G 4: 131,853,765 R110G probably benign Het
Mtrr T A 13: 68,566,973 K445* probably null Het
Nanos1 T A 19: 60,756,552 L96Q probably benign Het
Olfr538 T G 7: 140,574,156 M1R probably null Het
Olfr574 T A 7: 102,949,493 F333I probably benign Het
Olfr807 T A 10: 129,755,152 L99F probably damaging Het
Otog T C 7: 46,305,590 probably null Het
Pcdhb3 T A 18: 37,301,239 L86* probably null Het
Pcdhb3 A T 18: 37,301,240 L86F probably damaging Het
Pcdhb3 G T 18: 37,301,241 V87F probably benign Het
Pdgfd A G 9: 6,359,894 K322E probably damaging Het
Picalm T C 7: 90,197,009 S648P probably damaging Het
Pigr T C 1: 130,846,620 S446P possibly damaging Het
Pik3cb A C 9: 99,061,842 L636W probably damaging Het
Pla2g2f A T 4: 138,754,162 L92Q probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prkar2b C T 12: 31,975,929 V191I possibly damaging Het
Prune1 C A 3: 95,258,119 A281S probably benign Het
Ptges3l A T 11: 101,424,042 C42S possibly damaging Het
Reg3b A T 6: 78,371,819 I33L probably benign Het
Rel A G 11: 23,745,823 I188T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor1 G T 8: 105,617,622 V463L probably benign Het
Rrm1 T A 7: 102,460,689 D510E probably damaging Het
Setd7 A G 3: 51,533,015 S202P probably damaging Het
Shank3 T A 15: 89,548,686 D1211E probably benign Het
Slc30a1 A T 1: 191,907,562 T186S possibly damaging Het
Slc4a4 G A 5: 89,156,398 V523I probably benign Het
Slc9a2 T A 1: 40,742,608 probably null Het
Smg6 A G 11: 74,929,676 T258A probably damaging Het
Sptlc1 C T 13: 53,337,640 D408N possibly damaging Het
Tbl3 T C 17: 24,704,550 probably null Het
Tdo2 T C 3: 81,969,505 D139G possibly damaging Het
Ticam1 T A 17: 56,271,612 H161L possibly damaging Het
Tnfaip3 T A 10: 19,005,659 D293V probably benign Het
Trim72 G A 7: 128,004,706 V75M possibly damaging Het
Trip11 T A 12: 101,837,727 N1632I possibly damaging Het
Tspan18 A T 2: 93,220,095 M61K possibly damaging Het
Tuba8 A T 6: 121,225,973 E415V probably damaging Het
Ung A G 5: 114,137,192 H214R probably benign Het
Uqcrc1 T C 9: 108,936,768 L17P probably damaging Het
Usp24 A G 4: 106,379,405 probably null Het
Vps39 A C 2: 120,338,787 Y245D probably damaging Het
Whrn T A 4: 63,435,412 T373S probably benign Het
Zc2hc1a C T 3: 7,516,536 probably null Het
Other mutations in Eif2ak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Eif2ak4 APN 2 118464055 missense probably damaging 1.00
IGL00806:Eif2ak4 APN 2 118441166 missense probably benign 0.08
IGL01343:Eif2ak4 APN 2 118422089 missense probably benign 0.00
IGL01796:Eif2ak4 APN 2 118446304 missense probably benign 0.10
IGL02263:Eif2ak4 APN 2 118461778 missense probably benign 0.00
IGL02391:Eif2ak4 APN 2 118420791 missense probably benign 0.19
IGL02516:Eif2ak4 APN 2 118436254 missense probably damaging 1.00
IGL02603:Eif2ak4 APN 2 118450326 missense probably damaging 1.00
IGL02731:Eif2ak4 APN 2 118388814 missense probably benign
IGL02928:Eif2ak4 APN 2 118472687 critical splice donor site probably null
IGL02947:Eif2ak4 APN 2 118431033 missense probably benign 0.00
IGL03191:Eif2ak4 APN 2 118422212 missense probably damaging 1.00
IGL03202:Eif2ak4 APN 2 118400620 missense probably damaging 1.00
IGL03235:Eif2ak4 APN 2 118443140 missense probably damaging 1.00
IGL03375:Eif2ak4 APN 2 118422318 missense probably benign 0.08
absurdum UTSW 2 118420810 nonsense probably null
Ad UTSW 2 118436241 missense probably damaging 1.00
atchoum UTSW 2 118400653 splice site probably benign
reductio UTSW 2 118436158 splice site probably null
PIT4520001:Eif2ak4 UTSW 2 118462327 missense probably damaging 1.00
R0023:Eif2ak4 UTSW 2 118462721 missense probably damaging 1.00
R0358:Eif2ak4 UTSW 2 118463929 intron probably null
R0482:Eif2ak4 UTSW 2 118462347 missense probably damaging 1.00
R0505:Eif2ak4 UTSW 2 118431036 missense probably benign 0.01
R0523:Eif2ak4 UTSW 2 118442096 critical splice donor site probably null
R0578:Eif2ak4 UTSW 2 118474991 splice site probably benign
R0615:Eif2ak4 UTSW 2 118436185 missense probably damaging 1.00
R1300:Eif2ak4 UTSW 2 118463983 missense possibly damaging 0.79
R1531:Eif2ak4 UTSW 2 118443210 missense probably damaging 1.00
R1777:Eif2ak4 UTSW 2 118430839 missense probably damaging 0.98
R1866:Eif2ak4 UTSW 2 118472661 missense probably damaging 1.00
R1932:Eif2ak4 UTSW 2 118448486 missense probably damaging 1.00
R1977:Eif2ak4 UTSW 2 118461757 nonsense probably null
R2011:Eif2ak4 UTSW 2 118430947 missense probably damaging 1.00
R2046:Eif2ak4 UTSW 2 118451408 splice site probably benign
R2122:Eif2ak4 UTSW 2 118455793 missense probably damaging 1.00
R2125:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2126:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2193:Eif2ak4 UTSW 2 118422266 missense probably benign 0.12
R2259:Eif2ak4 UTSW 2 118455783 missense probably damaging 0.97
R3798:Eif2ak4 UTSW 2 118474083 missense probably damaging 1.00
R3898:Eif2ak4 UTSW 2 118430923 missense probably damaging 1.00
R3900:Eif2ak4 UTSW 2 118475029 missense probably damaging 1.00
R4375:Eif2ak4 UTSW 2 118427924 missense probably damaging 1.00
R4423:Eif2ak4 UTSW 2 118439066 missense probably benign 0.01
R4589:Eif2ak4 UTSW 2 118417338 missense probably damaging 1.00
R4734:Eif2ak4 UTSW 2 118422087 missense probably damaging 1.00
R5173:Eif2ak4 UTSW 2 118408360 missense probably damaging 1.00
R5367:Eif2ak4 UTSW 2 118436158 splice site probably null
R5471:Eif2ak4 UTSW 2 118474132 missense probably benign 0.02
R5528:Eif2ak4 UTSW 2 118427938 missense probably damaging 1.00
R5634:Eif2ak4 UTSW 2 118462311 missense probably damaging 1.00
R5726:Eif2ak4 UTSW 2 118443132 missense probably damaging 1.00
R5756:Eif2ak4 UTSW 2 118462740 missense possibly damaging 0.95
R5779:Eif2ak4 UTSW 2 118412963 missense possibly damaging 0.85
R5807:Eif2ak4 UTSW 2 118388851 missense probably benign
R6045:Eif2ak4 UTSW 2 118388815 nonsense probably null
R6187:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R6193:Eif2ak4 UTSW 2 118400600 start gained probably benign
R6468:Eif2ak4 UTSW 2 118436241 missense probably damaging 1.00
R6555:Eif2ak4 UTSW 2 118427869 missense probably damaging 0.96
R6616:Eif2ak4 UTSW 2 118454845 nonsense probably null
R6737:Eif2ak4 UTSW 2 118462268 frame shift probably null
R6956:Eif2ak4 UTSW 2 118422267 missense probably damaging 0.96
R7075:Eif2ak4 UTSW 2 118420810 nonsense probably null
R7109:Eif2ak4 UTSW 2 118405051 missense probably damaging 1.00
R7228:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R7441:Eif2ak4 UTSW 2 118471896 missense probably benign 0.01
R7555:Eif2ak4 UTSW 2 118417283 missense possibly damaging 0.64
R7567:Eif2ak4 UTSW 2 118450314 missense probably benign
X0061:Eif2ak4 UTSW 2 118468176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGGATATGCAAACCATGAAATG -3'
(R):5'- TCTCAGTTTCAGGCTCTGTG -3'

Sequencing Primer
(F):5'- CATGAATTTGCCAATGTGT -3'
(R):5'- TTACACAGTGGGACCCTAGC -3'
Posted On2014-12-04