Incidental Mutation 'R2513:Dap3'
ID253566
Institutional Source Beutler Lab
Gene Symbol Dap3
Ensembl Gene ENSMUSG00000068921
Gene Namedeath associated protein 3
SynonymsDAP-3, 4921514D13Rik
MMRRC Submission 040419-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2513 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88920803-88951181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88928258 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 263 (V263A)
Ref Sequence ENSEMBL: ENSMUSP00000103115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090938] [ENSMUST00000107491] [ENSMUST00000172942] [ENSMUST00000173021] [ENSMUST00000173135] [ENSMUST00000174077] [ENSMUST00000174402]
Predicted Effect probably benign
Transcript: ENSMUST00000090938
AA Change: V263A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000088456
Gene: ENSMUSG00000068921
AA Change: V263A

DomainStartEndE-ValueType
Pfam:DAP3 97 392 2.1e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107491
AA Change: V263A

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103115
Gene: ENSMUSG00000068921
AA Change: V263A

DomainStartEndE-ValueType
Pfam:DAP3 97 306 1e-67 PFAM
Pfam:DAP3 300 362 6.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172942
SMART Domains Protein: ENSMUSP00000134145
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 63 133 4.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173021
SMART Domains Protein: ENSMUSP00000133314
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 92 200 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173094
SMART Domains Protein: ENSMUSP00000133486
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 9 140 6.5e-48 PFAM
Pfam:DAP3 134 251 4.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173135
AA Change: V258A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134422
Gene: ENSMUSG00000068921
AA Change: V258A

DomainStartEndE-ValueType
Pfam:DAP3 92 387 8e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173711
Predicted Effect probably benign
Transcript: ENSMUST00000174077
SMART Domains Protein: ENSMUSP00000134433
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 92 212 7.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174402
SMART Domains Protein: ENSMUSP00000133395
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 79 165 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174571
SMART Domains Protein: ENSMUSP00000133349
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 1 102 4.7e-36 PFAM
Pfam:DAP3 99 213 7e-24 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that also participates in apoptotic pathways which are initiated by tumor necrosis factor-alpha, Fas ligand, and gamma interferon. This protein potentially binds ATP/GTP and might be a functional partner of the mitoribosomal protein S27. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality with defects in mitochondria morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,661,852 T719A possibly damaging Het
9530053A07Rik C G 7: 28,131,635 S91C probably damaging Het
Abcc1 A G 16: 14,473,009 probably null Het
Aftph C T 11: 20,708,676 probably null Het
Als2 C A 1: 59,215,117 K360N probably benign Het
Atg2a T A 19: 6,258,046 probably null Het
Axl T C 7: 25,787,516 D22G probably benign Het
Baiap2 G A 11: 119,999,226 A438T probably benign Het
Bean1 G C 8: 104,182,011 A7P probably benign Het
Birc6 C G 17: 74,647,729 P3431R probably damaging Het
Camk1d A G 2: 5,714,236 M1T probably null Het
Carmil3 T C 14: 55,503,838 Y1027H probably damaging Het
Ccdc6 G A 10: 70,187,828 probably benign Het
Cemip C A 7: 83,942,025 V1280L probably benign Het
Cfap58 C A 19: 47,962,542 N447K probably benign Het
Chd3 A G 11: 69,360,645 L520P probably damaging Het
Col1a2 T A 6: 4,531,223 probably null Het
Cpne7 A C 8: 123,117,667 probably null Het
Ctla4 T C 1: 60,912,564 V84A probably damaging Het
Dhx57 T A 17: 80,241,949 probably null Het
Dlg5 C A 14: 24,164,525 K663N probably damaging Het
Dsg3 C A 18: 20,523,662 F196L possibly damaging Het
Eif2ak4 C A 2: 118,426,583 D402E probably damaging Het
Fam208b G T 13: 3,582,150 L784I possibly damaging Het
Fance T C 17: 28,318,094 V24A probably benign Het
Fasn A T 11: 120,814,748 L1149Q probably damaging Het
Flg T A 3: 93,279,786 S182T possibly damaging Het
Gm128 T A 3: 95,239,982 S334C possibly damaging Het
Gm3727 A C 14: 7,264,561 H31Q probably damaging Het
Gm4841 T G 18: 60,270,905 T39P probably damaging Het
Golgb1 G T 16: 36,915,151 V1587L possibly damaging Het
Golm1 G A 13: 59,642,258 P243S probably benign Het
Gstcd C A 3: 133,082,320 A206S possibly damaging Het
Gstcd C A 3: 133,082,321 K205N possibly damaging Het
Gtf3c1 A G 7: 125,681,173 V355A probably benign Het
Hhatl T C 9: 121,789,170 D173G probably benign Het
Kcnu1 T A 8: 25,905,966 C660S probably benign Het
Kctd8 T C 5: 69,110,645 D374G probably benign Het
Kif21a T C 15: 90,994,391 I229V possibly damaging Het
L3mbtl1 A T 2: 162,967,585 I702F probably benign Het
Lce1d T C 3: 92,685,759 probably benign Het
Lrig1 C T 6: 94,617,366 probably null Het
Lrp12 A T 15: 39,876,111 D563E probably damaging Het
Lrp2 C T 2: 69,506,374 probably null Het
Map3k5 G A 10: 20,094,455 V703I possibly damaging Het
Mecr A G 4: 131,853,765 R110G probably benign Het
Mtrr T A 13: 68,566,973 K445* probably null Het
Nanos1 T A 19: 60,756,552 L96Q probably benign Het
Olfr538 T G 7: 140,574,156 M1R probably null Het
Olfr574 T A 7: 102,949,493 F333I probably benign Het
Olfr807 T A 10: 129,755,152 L99F probably damaging Het
Otog T C 7: 46,305,590 probably null Het
Pcdhb3 T A 18: 37,301,239 L86* probably null Het
Pcdhb3 A T 18: 37,301,240 L86F probably damaging Het
Pcdhb3 G T 18: 37,301,241 V87F probably benign Het
Pdgfd A G 9: 6,359,894 K322E probably damaging Het
Picalm T C 7: 90,197,009 S648P probably damaging Het
Pigr T C 1: 130,846,620 S446P possibly damaging Het
Pik3cb A C 9: 99,061,842 L636W probably damaging Het
Pla2g2f A T 4: 138,754,162 L92Q probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prkar2b C T 12: 31,975,929 V191I possibly damaging Het
Prune1 C A 3: 95,258,119 A281S probably benign Het
Ptges3l A T 11: 101,424,042 C42S possibly damaging Het
Reg3b A T 6: 78,371,819 I33L probably benign Het
Rel A G 11: 23,745,823 I188T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor1 G T 8: 105,617,622 V463L probably benign Het
Rrm1 T A 7: 102,460,689 D510E probably damaging Het
Setd7 A G 3: 51,533,015 S202P probably damaging Het
Shank3 T A 15: 89,548,686 D1211E probably benign Het
Slc30a1 A T 1: 191,907,562 T186S possibly damaging Het
Slc4a4 G A 5: 89,156,398 V523I probably benign Het
Slc9a2 T A 1: 40,742,608 probably null Het
Smg6 A G 11: 74,929,676 T258A probably damaging Het
Sptlc1 C T 13: 53,337,640 D408N possibly damaging Het
Tbl3 T C 17: 24,704,550 probably null Het
Tdo2 T C 3: 81,969,505 D139G possibly damaging Het
Ticam1 T A 17: 56,271,612 H161L possibly damaging Het
Tnfaip3 T A 10: 19,005,659 D293V probably benign Het
Trim72 G A 7: 128,004,706 V75M possibly damaging Het
Trip11 T A 12: 101,837,727 N1632I possibly damaging Het
Tspan18 A T 2: 93,220,095 M61K possibly damaging Het
Tuba8 A T 6: 121,225,973 E415V probably damaging Het
Ung A G 5: 114,137,192 H214R probably benign Het
Uqcrc1 T C 9: 108,936,768 L17P probably damaging Het
Usp24 A G 4: 106,379,405 probably null Het
Vps39 A C 2: 120,338,787 Y245D probably damaging Het
Whrn T A 4: 63,435,412 T373S probably benign Het
Zc2hc1a C T 3: 7,516,536 probably null Het
Other mutations in Dap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Dap3 APN 3 88936228 missense probably benign 0.23
IGL02111:Dap3 APN 3 88929418 missense probably benign 0.26
IGL02453:Dap3 APN 3 88928327 missense probably benign 0.07
IGL02989:Dap3 APN 3 88930571 splice site probably benign
R0094:Dap3 UTSW 3 88927028 missense probably benign 0.01
R0665:Dap3 UTSW 3 88930997 nonsense probably null
R1853:Dap3 UTSW 3 88930926 missense probably damaging 1.00
R1885:Dap3 UTSW 3 88930974 missense probably damaging 1.00
R1887:Dap3 UTSW 3 88930974 missense probably damaging 1.00
R2351:Dap3 UTSW 3 88933563 critical splice donor site probably null
R4449:Dap3 UTSW 3 88949878 unclassified probably benign
R4749:Dap3 UTSW 3 88926310 missense probably benign 0.00
R5359:Dap3 UTSW 3 88930989 missense probably damaging 1.00
R5502:Dap3 UTSW 3 88925326 missense probably damaging 1.00
R6899:Dap3 UTSW 3 88933600 missense probably benign 0.01
R6919:Dap3 UTSW 3 88930989 missense probably damaging 0.98
R6946:Dap3 UTSW 3 88938216 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTGGCTTTACAATTCAGTC -3'
(R):5'- ACCAGTTATACCGTGTCCTAGC -3'

Sequencing Primer
(F):5'- ACATGGTTGTGAACTGTCCAC -3'
(R):5'- AGTTATACCGTGTCCTAGCCAGAG -3'
Posted On2014-12-04