Incidental Mutation 'R2513:Gstcd'
ID253576
Institutional Source Beutler Lab
Gene Symbol Gstcd
Ensembl Gene ENSMUSG00000028018
Gene Nameglutathione S-transferase, C-terminal domain containing
Synonyms
MMRRC Submission 040419-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2513 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location132981752-133092033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 133082320 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 206 (A206S)
Ref Sequence ENSEMBL: ENSMUSP00000079421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029651] [ENSMUST00000080583]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029651
AA Change: A206S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029651
Gene: ENSMUSG00000028018
AA Change: A206S

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 168 181 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
low complexity region 208 229 N/A INTRINSIC
Pfam:GidB 417 515 9e-9 PFAM
Pfam:Methyltransf_32 424 548 1.1e-15 PFAM
Pfam:MTS 430 508 5.3e-6 PFAM
Pfam:Methyltransf_31 440 571 2.6e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000080583
AA Change: A206S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079421
Gene: ENSMUSG00000028018
AA Change: A206S

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 168 181 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
low complexity region 208 229 N/A INTRINSIC
Pfam:GidB 418 516 1.5e-8 PFAM
Pfam:Methyltransf_32 424 548 1.1e-15 PFAM
Pfam:Methyltransf_31 440 569 2.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197381
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,661,852 T719A possibly damaging Het
9530053A07Rik C G 7: 28,131,635 S91C probably damaging Het
Abcc1 A G 16: 14,473,009 probably null Het
Aftph C T 11: 20,708,676 probably null Het
Als2 C A 1: 59,215,117 K360N probably benign Het
Atg2a T A 19: 6,258,046 probably null Het
Axl T C 7: 25,787,516 D22G probably benign Het
Baiap2 G A 11: 119,999,226 A438T probably benign Het
Bean1 G C 8: 104,182,011 A7P probably benign Het
Birc6 C G 17: 74,647,729 P3431R probably damaging Het
Camk1d A G 2: 5,714,236 M1T probably null Het
Carmil3 T C 14: 55,503,838 Y1027H probably damaging Het
Ccdc6 G A 10: 70,187,828 probably benign Het
Cemip C A 7: 83,942,025 V1280L probably benign Het
Cfap58 C A 19: 47,962,542 N447K probably benign Het
Chd3 A G 11: 69,360,645 L520P probably damaging Het
Col1a2 T A 6: 4,531,223 probably null Het
Cpne7 A C 8: 123,117,667 probably null Het
Ctla4 T C 1: 60,912,564 V84A probably damaging Het
Dap3 A G 3: 88,928,258 V263A probably benign Het
Dhx57 T A 17: 80,241,949 probably null Het
Dlg5 C A 14: 24,164,525 K663N probably damaging Het
Dsg3 C A 18: 20,523,662 F196L possibly damaging Het
Eif2ak4 C A 2: 118,426,583 D402E probably damaging Het
Fam208b G T 13: 3,582,150 L784I possibly damaging Het
Fance T C 17: 28,318,094 V24A probably benign Het
Fasn A T 11: 120,814,748 L1149Q probably damaging Het
Flg T A 3: 93,279,786 S182T possibly damaging Het
Gm128 T A 3: 95,239,982 S334C possibly damaging Het
Gm3727 A C 14: 7,264,561 H31Q probably damaging Het
Gm4841 T G 18: 60,270,905 T39P probably damaging Het
Golgb1 G T 16: 36,915,151 V1587L possibly damaging Het
Golm1 G A 13: 59,642,258 P243S probably benign Het
Gtf3c1 A G 7: 125,681,173 V355A probably benign Het
Hhatl T C 9: 121,789,170 D173G probably benign Het
Kcnu1 T A 8: 25,905,966 C660S probably benign Het
Kctd8 T C 5: 69,110,645 D374G probably benign Het
Kif21a T C 15: 90,994,391 I229V possibly damaging Het
L3mbtl1 A T 2: 162,967,585 I702F probably benign Het
Lce1d T C 3: 92,685,759 probably benign Het
Lrig1 C T 6: 94,617,366 probably null Het
Lrp12 A T 15: 39,876,111 D563E probably damaging Het
Lrp2 C T 2: 69,506,374 probably null Het
Map3k5 G A 10: 20,094,455 V703I possibly damaging Het
Mecr A G 4: 131,853,765 R110G probably benign Het
Mtrr T A 13: 68,566,973 K445* probably null Het
Nanos1 T A 19: 60,756,552 L96Q probably benign Het
Olfr538 T G 7: 140,574,156 M1R probably null Het
Olfr574 T A 7: 102,949,493 F333I probably benign Het
Olfr807 T A 10: 129,755,152 L99F probably damaging Het
Otog T C 7: 46,305,590 probably null Het
Pcdhb3 T A 18: 37,301,239 L86* probably null Het
Pcdhb3 A T 18: 37,301,240 L86F probably damaging Het
Pcdhb3 G T 18: 37,301,241 V87F probably benign Het
Pdgfd A G 9: 6,359,894 K322E probably damaging Het
Picalm T C 7: 90,197,009 S648P probably damaging Het
Pigr T C 1: 130,846,620 S446P possibly damaging Het
Pik3cb A C 9: 99,061,842 L636W probably damaging Het
Pla2g2f A T 4: 138,754,162 L92Q probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prkar2b C T 12: 31,975,929 V191I possibly damaging Het
Prune1 C A 3: 95,258,119 A281S probably benign Het
Ptges3l A T 11: 101,424,042 C42S possibly damaging Het
Reg3b A T 6: 78,371,819 I33L probably benign Het
Rel A G 11: 23,745,823 I188T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor1 G T 8: 105,617,622 V463L probably benign Het
Rrm1 T A 7: 102,460,689 D510E probably damaging Het
Setd7 A G 3: 51,533,015 S202P probably damaging Het
Shank3 T A 15: 89,548,686 D1211E probably benign Het
Slc30a1 A T 1: 191,907,562 T186S possibly damaging Het
Slc4a4 G A 5: 89,156,398 V523I probably benign Het
Slc9a2 T A 1: 40,742,608 probably null Het
Smg6 A G 11: 74,929,676 T258A probably damaging Het
Sptlc1 C T 13: 53,337,640 D408N possibly damaging Het
Tbl3 T C 17: 24,704,550 probably null Het
Tdo2 T C 3: 81,969,505 D139G possibly damaging Het
Ticam1 T A 17: 56,271,612 H161L possibly damaging Het
Tnfaip3 T A 10: 19,005,659 D293V probably benign Het
Trim72 G A 7: 128,004,706 V75M possibly damaging Het
Trip11 T A 12: 101,837,727 N1632I possibly damaging Het
Tspan18 A T 2: 93,220,095 M61K possibly damaging Het
Tuba8 A T 6: 121,225,973 E415V probably damaging Het
Ung A G 5: 114,137,192 H214R probably benign Het
Uqcrc1 T C 9: 108,936,768 L17P probably damaging Het
Usp24 A G 4: 106,379,405 probably null Het
Vps39 A C 2: 120,338,787 Y245D probably damaging Het
Whrn T A 4: 63,435,412 T373S probably benign Het
Zc2hc1a C T 3: 7,516,536 probably null Het
Other mutations in Gstcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Gstcd APN 3 132986414 missense probably damaging 0.96
IGL01800:Gstcd APN 3 133084574 critical splice donor site probably null
IGL02434:Gstcd APN 3 132996202 splice site probably benign
IGL02720:Gstcd APN 3 133071961 missense probably benign 0.00
R0367:Gstcd UTSW 3 132986377 splice site probably benign
R0378:Gstcd UTSW 3 132986408 missense probably damaging 1.00
R0382:Gstcd UTSW 3 132986408 missense probably damaging 1.00
R0465:Gstcd UTSW 3 132983144 missense probably benign 0.04
R1295:Gstcd UTSW 3 133005628 missense probably damaging 1.00
R1861:Gstcd UTSW 3 132983107 missense probably damaging 1.00
R2056:Gstcd UTSW 3 133082053 missense probably benign 0.00
R2331:Gstcd UTSW 3 132998880 missense probably damaging 0.98
R2513:Gstcd UTSW 3 133082321 missense possibly damaging 0.87
R3547:Gstcd UTSW 3 133084838 missense possibly damaging 0.86
R4022:Gstcd UTSW 3 133082068 missense probably damaging 1.00
R4713:Gstcd UTSW 3 132983099 missense probably damaging 1.00
R4877:Gstcd UTSW 3 133005553 splice site probably benign
R5152:Gstcd UTSW 3 133084956 missense possibly damaging 0.95
R5165:Gstcd UTSW 3 133084679 missense probably damaging 0.99
R6106:Gstcd UTSW 3 132998914 missense probably benign 0.02
R6177:Gstcd UTSW 3 133082073 missense probably damaging 1.00
R7100:Gstcd UTSW 3 133084943 missense probably benign 0.01
R7264:Gstcd UTSW 3 133084779 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGCAAACACGTGCTCCAG -3'
(R):5'- GACCAGGCTATGTGAACTCAC -3'

Sequencing Primer
(F):5'- GCTTTCCTGATGTGAGAAGGCTC -3'
(R):5'- GGCTATGTGAACTCACCATCC -3'
Posted On2014-12-04