Incidental Mutation 'R2513:Ung'
ID253594
Institutional Source Beutler Lab
Gene Symbol Ung
Ensembl Gene ENSMUSG00000029591
Gene Nameuracil DNA glycosylase
SynonymsUNG1
MMRRC Submission 040419-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R2513 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114130386-114139323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114137192 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 214 (H214R)
Ref Sequence ENSEMBL: ENSMUSP00000031587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031587] [ENSMUST00000102584] [ENSMUST00000112275] [ENSMUST00000137402] [ENSMUST00000143455]
Predicted Effect probably benign
Transcript: ENSMUST00000031587
AA Change: H214R

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031587
Gene: ENSMUSG00000029591
AA Change: H214R

DomainStartEndE-ValueType
low complexity region 72 81 N/A INTRINSIC
UDG 132 293 5.86e-35 SMART
UreE_C 132 293 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102584
AA Change: H203R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099644
Gene: ENSMUSG00000029591
AA Change: H203R

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
UDG 121 282 5.86e-35 SMART
UreE_C 121 282 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112275
AA Change: H107R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107894
Gene: ENSMUSG00000029591
AA Change: H107R

DomainStartEndE-ValueType
UDG 25 186 5.86e-35 SMART
UreE_C 25 186 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137402
AA Change: H117R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114140
Gene: ENSMUSG00000029591
AA Change: H117R

DomainStartEndE-ValueType
UDG 35 184 2.05e-25 SMART
UreE_C 35 184 2.05e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143455
SMART Domains Protein: ENSMUSP00000142484
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
PDB:2SSP|E 76 127 3e-27 PDB
SCOP:d3euga_ 79 127 1e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200479
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several uracil-DNA glycosylases. One important function of uracil-DNA glycosylases is to prevent mutagenesis by eliminating uracil from DNA molecules by cleaving the N-glycosylic bond and initiating the base-excision repair (BER) pathway. Uracil bases occur from cytosine deamination or misincorporation of dUMP residues. Alternative promoter usage and splicing of this gene leads to two different isoforms: the mitochondrial UNG1 and the nuclear UNG2. The UNG2 term was used as a previous symbol for the CCNO gene (GeneID 10309), which has been confused with this gene, in the literature and some databases. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mutants incorporate an elevated level of uracil into DNA of dividing cells. In hypermutation at immunoglobulin genes, mutations at C/G pairs are shifted toward transitions, and class-switch recombination is reduced. Homozygous null mutants display increased ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,661,852 T719A possibly damaging Het
9530053A07Rik C G 7: 28,131,635 S91C probably damaging Het
Abcc1 A G 16: 14,473,009 probably null Het
Aftph C T 11: 20,708,676 probably null Het
Als2 C A 1: 59,215,117 K360N probably benign Het
Atg2a T A 19: 6,258,046 probably null Het
Axl T C 7: 25,787,516 D22G probably benign Het
Baiap2 G A 11: 119,999,226 A438T probably benign Het
Bean1 G C 8: 104,182,011 A7P probably benign Het
Birc6 C G 17: 74,647,729 P3431R probably damaging Het
Camk1d A G 2: 5,714,236 M1T probably null Het
Carmil3 T C 14: 55,503,838 Y1027H probably damaging Het
Ccdc6 G A 10: 70,187,828 probably benign Het
Cemip C A 7: 83,942,025 V1280L probably benign Het
Cfap58 C A 19: 47,962,542 N447K probably benign Het
Chd3 A G 11: 69,360,645 L520P probably damaging Het
Col1a2 T A 6: 4,531,223 probably null Het
Cpne7 A C 8: 123,117,667 probably null Het
Ctla4 T C 1: 60,912,564 V84A probably damaging Het
Dap3 A G 3: 88,928,258 V263A probably benign Het
Dhx57 T A 17: 80,241,949 probably null Het
Dlg5 C A 14: 24,164,525 K663N probably damaging Het
Dsg3 C A 18: 20,523,662 F196L possibly damaging Het
Eif2ak4 C A 2: 118,426,583 D402E probably damaging Het
Fam208b G T 13: 3,582,150 L784I possibly damaging Het
Fance T C 17: 28,318,094 V24A probably benign Het
Fasn A T 11: 120,814,748 L1149Q probably damaging Het
Flg T A 3: 93,279,786 S182T possibly damaging Het
Gm128 T A 3: 95,239,982 S334C possibly damaging Het
Gm3727 A C 14: 7,264,561 H31Q probably damaging Het
Gm4841 T G 18: 60,270,905 T39P probably damaging Het
Golgb1 G T 16: 36,915,151 V1587L possibly damaging Het
Golm1 G A 13: 59,642,258 P243S probably benign Het
Gstcd C A 3: 133,082,320 A206S possibly damaging Het
Gstcd C A 3: 133,082,321 K205N possibly damaging Het
Gtf3c1 A G 7: 125,681,173 V355A probably benign Het
Hhatl T C 9: 121,789,170 D173G probably benign Het
Kcnu1 T A 8: 25,905,966 C660S probably benign Het
Kctd8 T C 5: 69,110,645 D374G probably benign Het
Kif21a T C 15: 90,994,391 I229V possibly damaging Het
L3mbtl1 A T 2: 162,967,585 I702F probably benign Het
Lce1d T C 3: 92,685,759 probably benign Het
Lrig1 C T 6: 94,617,366 probably null Het
Lrp12 A T 15: 39,876,111 D563E probably damaging Het
Lrp2 C T 2: 69,506,374 probably null Het
Map3k5 G A 10: 20,094,455 V703I possibly damaging Het
Mecr A G 4: 131,853,765 R110G probably benign Het
Mtrr T A 13: 68,566,973 K445* probably null Het
Nanos1 T A 19: 60,756,552 L96Q probably benign Het
Olfr538 T G 7: 140,574,156 M1R probably null Het
Olfr574 T A 7: 102,949,493 F333I probably benign Het
Olfr807 T A 10: 129,755,152 L99F probably damaging Het
Otog T C 7: 46,305,590 probably null Het
Pcdhb3 T A 18: 37,301,239 L86* probably null Het
Pcdhb3 A T 18: 37,301,240 L86F probably damaging Het
Pcdhb3 G T 18: 37,301,241 V87F probably benign Het
Pdgfd A G 9: 6,359,894 K322E probably damaging Het
Picalm T C 7: 90,197,009 S648P probably damaging Het
Pigr T C 1: 130,846,620 S446P possibly damaging Het
Pik3cb A C 9: 99,061,842 L636W probably damaging Het
Pla2g2f A T 4: 138,754,162 L92Q probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prkar2b C T 12: 31,975,929 V191I possibly damaging Het
Prune1 C A 3: 95,258,119 A281S probably benign Het
Ptges3l A T 11: 101,424,042 C42S possibly damaging Het
Reg3b A T 6: 78,371,819 I33L probably benign Het
Rel A G 11: 23,745,823 I188T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor1 G T 8: 105,617,622 V463L probably benign Het
Rrm1 T A 7: 102,460,689 D510E probably damaging Het
Setd7 A G 3: 51,533,015 S202P probably damaging Het
Shank3 T A 15: 89,548,686 D1211E probably benign Het
Slc30a1 A T 1: 191,907,562 T186S possibly damaging Het
Slc4a4 G A 5: 89,156,398 V523I probably benign Het
Slc9a2 T A 1: 40,742,608 probably null Het
Smg6 A G 11: 74,929,676 T258A probably damaging Het
Sptlc1 C T 13: 53,337,640 D408N possibly damaging Het
Tbl3 T C 17: 24,704,550 probably null Het
Tdo2 T C 3: 81,969,505 D139G possibly damaging Het
Ticam1 T A 17: 56,271,612 H161L possibly damaging Het
Tnfaip3 T A 10: 19,005,659 D293V probably benign Het
Trim72 G A 7: 128,004,706 V75M possibly damaging Het
Trip11 T A 12: 101,837,727 N1632I possibly damaging Het
Tspan18 A T 2: 93,220,095 M61K possibly damaging Het
Tuba8 A T 6: 121,225,973 E415V probably damaging Het
Uqcrc1 T C 9: 108,936,768 L17P probably damaging Het
Usp24 A G 4: 106,379,405 probably null Het
Vps39 A C 2: 120,338,787 Y245D probably damaging Het
Whrn T A 4: 63,435,412 T373S probably benign Het
Zc2hc1a C T 3: 7,516,536 probably null Het
Other mutations in Ung
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ung APN 5 114137308 missense possibly damaging 0.50
IGL01995:Ung APN 5 114136386 missense probably benign 0.30
IGL02084:Ung APN 5 114130576 missense probably benign 0.00
R1219:Ung UTSW 5 114132167 unclassified probably benign
R1617:Ung UTSW 5 114131354 missense probably benign 0.14
R4078:Ung UTSW 5 114130623 unclassified probably null
R4079:Ung UTSW 5 114130623 unclassified probably null
R6210:Ung UTSW 5 114131377 missense probably benign 0.15
R6258:Ung UTSW 5 114137300 missense probably benign 0.12
R6954:Ung UTSW 5 114131337 missense probably benign 0.25
R7288:Ung UTSW 5 114131254 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATGAAACATAACACCCTGTGTG -3'
(R):5'- CTATGCTGTGCACATGAGCG -3'

Sequencing Primer
(F):5'- TGTGACTCACGGGTCCCTC -3'
(R):5'- TGCACATGAGCGGGCAC -3'
Posted On2014-12-04