Incidental Mutation 'R2513:Ripor1'
ID253631
Institutional Source Beutler Lab
Gene Symbol Ripor1
Ensembl Gene ENSMUSG00000038604
Gene NameRHO family interacting cell polarization regulator 1
SynonymsFam65a, 2310066E14Rik
MMRRC Submission 040419-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R2513 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105605255-105622219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105617622 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 463 (V463L)
Ref Sequence ENSEMBL: ENSMUSP00000039966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043531] [ENSMUST00000194091]
Predicted Effect probably benign
Transcript: ENSMUST00000043531
AA Change: V463L

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039966
Gene: ENSMUSG00000038604
AA Change: V463L

DomainStartEndE-ValueType
Pfam:PL48 17 365 1.7e-170 PFAM
low complexity region 376 391 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 564 586 N/A INTRINSIC
low complexity region 595 655 N/A INTRINSIC
low complexity region 673 688 N/A INTRINSIC
low complexity region 748 771 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
Pfam:HEAT_2 1135 1209 3.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158807
Predicted Effect probably benign
Transcript: ENSMUST00000194091
SMART Domains Protein: ENSMUSP00000142044
Gene: ENSMUSG00000005705

DomainStartEndE-ValueType
Agouti 1 121 2.01e-56 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,661,852 T719A possibly damaging Het
9530053A07Rik C G 7: 28,131,635 S91C probably damaging Het
Abcc1 A G 16: 14,473,009 probably null Het
Aftph C T 11: 20,708,676 probably null Het
Als2 C A 1: 59,215,117 K360N probably benign Het
Atg2a T A 19: 6,258,046 probably null Het
Axl T C 7: 25,787,516 D22G probably benign Het
Baiap2 G A 11: 119,999,226 A438T probably benign Het
Bean1 G C 8: 104,182,011 A7P probably benign Het
Birc6 C G 17: 74,647,729 P3431R probably damaging Het
Camk1d A G 2: 5,714,236 M1T probably null Het
Carmil3 T C 14: 55,503,838 Y1027H probably damaging Het
Ccdc6 G A 10: 70,187,828 probably benign Het
Cemip C A 7: 83,942,025 V1280L probably benign Het
Cfap58 C A 19: 47,962,542 N447K probably benign Het
Chd3 A G 11: 69,360,645 L520P probably damaging Het
Col1a2 T A 6: 4,531,223 probably null Het
Cpne7 A C 8: 123,117,667 probably null Het
Ctla4 T C 1: 60,912,564 V84A probably damaging Het
Dap3 A G 3: 88,928,258 V263A probably benign Het
Dhx57 T A 17: 80,241,949 probably null Het
Dlg5 C A 14: 24,164,525 K663N probably damaging Het
Dsg3 C A 18: 20,523,662 F196L possibly damaging Het
Eif2ak4 C A 2: 118,426,583 D402E probably damaging Het
Fam208b G T 13: 3,582,150 L784I possibly damaging Het
Fance T C 17: 28,318,094 V24A probably benign Het
Fasn A T 11: 120,814,748 L1149Q probably damaging Het
Flg T A 3: 93,279,786 S182T possibly damaging Het
Gm128 T A 3: 95,239,982 S334C possibly damaging Het
Gm3727 A C 14: 7,264,561 H31Q probably damaging Het
Gm4841 T G 18: 60,270,905 T39P probably damaging Het
Golgb1 G T 16: 36,915,151 V1587L possibly damaging Het
Golm1 G A 13: 59,642,258 P243S probably benign Het
Gstcd C A 3: 133,082,320 A206S possibly damaging Het
Gstcd C A 3: 133,082,321 K205N possibly damaging Het
Gtf3c1 A G 7: 125,681,173 V355A probably benign Het
Hhatl T C 9: 121,789,170 D173G probably benign Het
Kcnu1 T A 8: 25,905,966 C660S probably benign Het
Kctd8 T C 5: 69,110,645 D374G probably benign Het
Kif21a T C 15: 90,994,391 I229V possibly damaging Het
L3mbtl1 A T 2: 162,967,585 I702F probably benign Het
Lce1d T C 3: 92,685,759 probably benign Het
Lrig1 C T 6: 94,617,366 probably null Het
Lrp12 A T 15: 39,876,111 D563E probably damaging Het
Lrp2 C T 2: 69,506,374 probably null Het
Map3k5 G A 10: 20,094,455 V703I possibly damaging Het
Mecr A G 4: 131,853,765 R110G probably benign Het
Mtrr T A 13: 68,566,973 K445* probably null Het
Nanos1 T A 19: 60,756,552 L96Q probably benign Het
Olfr538 T G 7: 140,574,156 M1R probably null Het
Olfr574 T A 7: 102,949,493 F333I probably benign Het
Olfr807 T A 10: 129,755,152 L99F probably damaging Het
Otog T C 7: 46,305,590 probably null Het
Pcdhb3 T A 18: 37,301,239 L86* probably null Het
Pcdhb3 A T 18: 37,301,240 L86F probably damaging Het
Pcdhb3 G T 18: 37,301,241 V87F probably benign Het
Pdgfd A G 9: 6,359,894 K322E probably damaging Het
Picalm T C 7: 90,197,009 S648P probably damaging Het
Pigr T C 1: 130,846,620 S446P possibly damaging Het
Pik3cb A C 9: 99,061,842 L636W probably damaging Het
Pla2g2f A T 4: 138,754,162 L92Q probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prkar2b C T 12: 31,975,929 V191I possibly damaging Het
Prune1 C A 3: 95,258,119 A281S probably benign Het
Ptges3l A T 11: 101,424,042 C42S possibly damaging Het
Reg3b A T 6: 78,371,819 I33L probably benign Het
Rel A G 11: 23,745,823 I188T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rrm1 T A 7: 102,460,689 D510E probably damaging Het
Setd7 A G 3: 51,533,015 S202P probably damaging Het
Shank3 T A 15: 89,548,686 D1211E probably benign Het
Slc30a1 A T 1: 191,907,562 T186S possibly damaging Het
Slc4a4 G A 5: 89,156,398 V523I probably benign Het
Slc9a2 T A 1: 40,742,608 probably null Het
Smg6 A G 11: 74,929,676 T258A probably damaging Het
Sptlc1 C T 13: 53,337,640 D408N possibly damaging Het
Tbl3 T C 17: 24,704,550 probably null Het
Tdo2 T C 3: 81,969,505 D139G possibly damaging Het
Ticam1 T A 17: 56,271,612 H161L possibly damaging Het
Tnfaip3 T A 10: 19,005,659 D293V probably benign Het
Trim72 G A 7: 128,004,706 V75M possibly damaging Het
Trip11 T A 12: 101,837,727 N1632I possibly damaging Het
Tspan18 A T 2: 93,220,095 M61K possibly damaging Het
Tuba8 A T 6: 121,225,973 E415V probably damaging Het
Ung A G 5: 114,137,192 H214R probably benign Het
Uqcrc1 T C 9: 108,936,768 L17P probably damaging Het
Usp24 A G 4: 106,379,405 probably null Het
Vps39 A C 2: 120,338,787 Y245D probably damaging Het
Whrn T A 4: 63,435,412 T373S probably benign Het
Zc2hc1a C T 3: 7,516,536 probably null Het
Other mutations in Ripor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Ripor1 APN 8 105621433 intron probably benign
IGL00658:Ripor1 APN 8 105618117 intron probably benign
IGL01511:Ripor1 APN 8 105619930 intron probably benign
IGL01733:Ripor1 APN 8 105615746 missense possibly damaging 0.63
IGL02805:Ripor1 APN 8 105617571 missense probably damaging 0.99
IGL03049:Ripor1 APN 8 105615447 missense probably damaging 0.96
IGL03246:Ripor1 APN 8 105615858 missense possibly damaging 0.92
R0650:Ripor1 UTSW 8 105618114 intron probably benign
R1109:Ripor1 UTSW 8 105618928 intron probably benign
R1480:Ripor1 UTSW 8 105615548 missense probably damaging 0.96
R1914:Ripor1 UTSW 8 105616886 missense probably damaging 1.00
R1915:Ripor1 UTSW 8 105616886 missense probably damaging 1.00
R2067:Ripor1 UTSW 8 105617708 missense probably benign 0.05
R2111:Ripor1 UTSW 8 105614712 missense probably damaging 1.00
R4119:Ripor1 UTSW 8 105618857 intron probably benign
R4120:Ripor1 UTSW 8 105618857 intron probably benign
R4415:Ripor1 UTSW 8 105617976 missense probably benign 0.10
R4668:Ripor1 UTSW 8 105614652 missense probably benign 0.30
R4679:Ripor1 UTSW 8 105617785 missense possibly damaging 0.94
R4777:Ripor1 UTSW 8 105614990 missense probably damaging 1.00
R4930:Ripor1 UTSW 8 105617182 missense probably damaging 1.00
R5004:Ripor1 UTSW 8 105618820 frame shift probably null
R5569:Ripor1 UTSW 8 105617515 missense probably damaging 0.98
R5868:Ripor1 UTSW 8 105616004 missense probably damaging 1.00
R7187:Ripor1 UTSW 8 105617874 missense probably benign 0.22
R7311:Ripor1 UTSW 8 105617815 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGATTCATCAAGCCCGCAG -3'
(R):5'- CCAAGTCTAGCTGTGTCGTTG -3'

Sequencing Primer
(F):5'- AAGCCTCTGGTGCAACAG -3'
(R):5'- CGTTGGGGCAGGGTCTATAAATG -3'
Posted On2014-12-04