Incidental Mutation 'R2513:Pik3cb'
ID253637
Institutional Source Beutler Lab
Gene Symbol Pik3cb
Ensembl Gene ENSMUSG00000032462
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonymsp110beta, 1110001J02Rik
MMRRC Submission 040419-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R2513 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location99036654-99140621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 99061842 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 636 (L636W)
Ref Sequence ENSEMBL: ENSMUSP00000035037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035037] [ENSMUST00000136965]
PDB Structure
CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Discovery and Optimization of Pyrimidone Indoline Amide PI3Kbeta Inhibitors for the Treatment of Phosphatase and TENsin homologue (PTEN)-Deficient Cancers [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035037
AA Change: L636W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035037
Gene: ENSMUSG00000032462
AA Change: L636W

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
PI3Ka 519 705 1.08e-92 SMART
PI3Kc 795 1061 8.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136965
SMART Domains Protein: ENSMUSP00000138346
Gene: ENSMUSG00000032462

DomainStartEndE-ValueType
PI3K_p85B 35 112 2.44e-50 SMART
PI3K_rbd 174 282 1.88e-42 SMART
low complexity region 305 311 N/A INTRINSIC
PI3K_C2 315 417 4.64e-33 SMART
Blast:PI3Ka 450 520 1e-37 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit 30% fetal lethality, decreased size at birth and postnatally, abnormal glucose homeostasis, and dyslipidemia. Mice homozygous for a different knock-out allele die prior to E8.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,661,852 T719A possibly damaging Het
9530053A07Rik C G 7: 28,131,635 S91C probably damaging Het
Abcc1 A G 16: 14,473,009 probably null Het
Aftph C T 11: 20,708,676 probably null Het
Als2 C A 1: 59,215,117 K360N probably benign Het
Atg2a T A 19: 6,258,046 probably null Het
Axl T C 7: 25,787,516 D22G probably benign Het
Baiap2 G A 11: 119,999,226 A438T probably benign Het
Bean1 G C 8: 104,182,011 A7P probably benign Het
Birc6 C G 17: 74,647,729 P3431R probably damaging Het
Camk1d A G 2: 5,714,236 M1T probably null Het
Carmil3 T C 14: 55,503,838 Y1027H probably damaging Het
Ccdc6 G A 10: 70,187,828 probably benign Het
Cemip C A 7: 83,942,025 V1280L probably benign Het
Cfap58 C A 19: 47,962,542 N447K probably benign Het
Chd3 A G 11: 69,360,645 L520P probably damaging Het
Col1a2 T A 6: 4,531,223 probably null Het
Cpne7 A C 8: 123,117,667 probably null Het
Ctla4 T C 1: 60,912,564 V84A probably damaging Het
Dap3 A G 3: 88,928,258 V263A probably benign Het
Dhx57 T A 17: 80,241,949 probably null Het
Dlg5 C A 14: 24,164,525 K663N probably damaging Het
Dsg3 C A 18: 20,523,662 F196L possibly damaging Het
Eif2ak4 C A 2: 118,426,583 D402E probably damaging Het
Fam208b G T 13: 3,582,150 L784I possibly damaging Het
Fance T C 17: 28,318,094 V24A probably benign Het
Fasn A T 11: 120,814,748 L1149Q probably damaging Het
Flg T A 3: 93,279,786 S182T possibly damaging Het
Gm128 T A 3: 95,239,982 S334C possibly damaging Het
Gm3727 A C 14: 7,264,561 H31Q probably damaging Het
Gm4841 T G 18: 60,270,905 T39P probably damaging Het
Golgb1 G T 16: 36,915,151 V1587L possibly damaging Het
Golm1 G A 13: 59,642,258 P243S probably benign Het
Gstcd C A 3: 133,082,320 A206S possibly damaging Het
Gstcd C A 3: 133,082,321 K205N possibly damaging Het
Gtf3c1 A G 7: 125,681,173 V355A probably benign Het
Hhatl T C 9: 121,789,170 D173G probably benign Het
Kcnu1 T A 8: 25,905,966 C660S probably benign Het
Kctd8 T C 5: 69,110,645 D374G probably benign Het
Kif21a T C 15: 90,994,391 I229V possibly damaging Het
L3mbtl1 A T 2: 162,967,585 I702F probably benign Het
Lce1d T C 3: 92,685,759 probably benign Het
Lrig1 C T 6: 94,617,366 probably null Het
Lrp12 A T 15: 39,876,111 D563E probably damaging Het
Lrp2 C T 2: 69,506,374 probably null Het
Map3k5 G A 10: 20,094,455 V703I possibly damaging Het
Mecr A G 4: 131,853,765 R110G probably benign Het
Mtrr T A 13: 68,566,973 K445* probably null Het
Nanos1 T A 19: 60,756,552 L96Q probably benign Het
Olfr538 T G 7: 140,574,156 M1R probably null Het
Olfr574 T A 7: 102,949,493 F333I probably benign Het
Olfr807 T A 10: 129,755,152 L99F probably damaging Het
Otog T C 7: 46,305,590 probably null Het
Pcdhb3 T A 18: 37,301,239 L86* probably null Het
Pcdhb3 A T 18: 37,301,240 L86F probably damaging Het
Pcdhb3 G T 18: 37,301,241 V87F probably benign Het
Pdgfd A G 9: 6,359,894 K322E probably damaging Het
Picalm T C 7: 90,197,009 S648P probably damaging Het
Pigr T C 1: 130,846,620 S446P possibly damaging Het
Pla2g2f A T 4: 138,754,162 L92Q probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prkar2b C T 12: 31,975,929 V191I possibly damaging Het
Prune1 C A 3: 95,258,119 A281S probably benign Het
Ptges3l A T 11: 101,424,042 C42S possibly damaging Het
Reg3b A T 6: 78,371,819 I33L probably benign Het
Rel A G 11: 23,745,823 I188T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor1 G T 8: 105,617,622 V463L probably benign Het
Rrm1 T A 7: 102,460,689 D510E probably damaging Het
Setd7 A G 3: 51,533,015 S202P probably damaging Het
Shank3 T A 15: 89,548,686 D1211E probably benign Het
Slc30a1 A T 1: 191,907,562 T186S possibly damaging Het
Slc4a4 G A 5: 89,156,398 V523I probably benign Het
Slc9a2 T A 1: 40,742,608 probably null Het
Smg6 A G 11: 74,929,676 T258A probably damaging Het
Sptlc1 C T 13: 53,337,640 D408N possibly damaging Het
Tbl3 T C 17: 24,704,550 probably null Het
Tdo2 T C 3: 81,969,505 D139G possibly damaging Het
Ticam1 T A 17: 56,271,612 H161L possibly damaging Het
Tnfaip3 T A 10: 19,005,659 D293V probably benign Het
Trim72 G A 7: 128,004,706 V75M possibly damaging Het
Trip11 T A 12: 101,837,727 N1632I possibly damaging Het
Tspan18 A T 2: 93,220,095 M61K possibly damaging Het
Tuba8 A T 6: 121,225,973 E415V probably damaging Het
Ung A G 5: 114,137,192 H214R probably benign Het
Uqcrc1 T C 9: 108,936,768 L17P probably damaging Het
Usp24 A G 4: 106,379,405 probably null Het
Vps39 A C 2: 120,338,787 Y245D probably damaging Het
Whrn T A 4: 63,435,412 T373S probably benign Het
Zc2hc1a C T 3: 7,516,536 probably null Het
Other mutations in Pik3cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Pik3cb APN 9 99101286 missense probably damaging 0.96
IGL01354:Pik3cb APN 9 99064168 missense possibly damaging 0.83
IGL02132:Pik3cb APN 9 99071377 missense probably benign 0.01
IGL02268:Pik3cb APN 9 99046556 missense probably benign 0.00
IGL02376:Pik3cb APN 9 99052352 missense probably benign 0.00
IGL02378:Pik3cb APN 9 99062840 missense probably benign 0.40
IGL02748:Pik3cb APN 9 99062968 splice site probably benign
IGL03038:Pik3cb APN 9 99065597 missense probably damaging 1.00
IGL03142:Pik3cb APN 9 99065562 missense probably benign 0.10
H8786:Pik3cb UTSW 9 99046559 missense possibly damaging 0.80
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0071:Pik3cb UTSW 9 99044865 missense probably benign 0.02
R0305:Pik3cb UTSW 9 99064076 missense possibly damaging 0.86
R0464:Pik3cb UTSW 9 99044743 critical splice donor site probably null
R0635:Pik3cb UTSW 9 99064218 splice site probably benign
R1386:Pik3cb UTSW 9 99064027 missense possibly damaging 0.90
R1530:Pik3cb UTSW 9 99053973 missense probably damaging 0.96
R1802:Pik3cb UTSW 9 99101289 nonsense probably null
R1815:Pik3cb UTSW 9 99093095 missense possibly damaging 0.93
R2011:Pik3cb UTSW 9 99105579 nonsense probably null
R2079:Pik3cb UTSW 9 99060204 missense probably benign 0.27
R2153:Pik3cb UTSW 9 99101244 nonsense probably null
R2237:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R2238:Pik3cb UTSW 9 99041028 missense probably damaging 1.00
R3982:Pik3cb UTSW 9 99046601 missense probably benign 0.06
R4009:Pik3cb UTSW 9 99040929 missense probably damaging 0.98
R4246:Pik3cb UTSW 9 99101176 splice site probably null
R4248:Pik3cb UTSW 9 99101176 splice site probably null
R4249:Pik3cb UTSW 9 99101176 splice site probably null
R4334:Pik3cb UTSW 9 99061851 missense probably damaging 1.00
R4544:Pik3cb UTSW 9 99039759 missense probably damaging 1.00
R4568:Pik3cb UTSW 9 99090302 missense probably benign 0.00
R4571:Pik3cb UTSW 9 99090257 missense possibly damaging 0.94
R4595:Pik3cb UTSW 9 99055406 missense possibly damaging 0.95
R4599:Pik3cb UTSW 9 99061764 missense probably benign 0.15
R4820:Pik3cb UTSW 9 99073626 missense probably benign 0.00
R4887:Pik3cb UTSW 9 99101328 missense probably damaging 0.99
R4967:Pik3cb UTSW 9 99105632 missense probably benign 0.14
R5029:Pik3cb UTSW 9 99054060 missense probably damaging 0.98
R5031:Pik3cb UTSW 9 99071408 missense probably damaging 1.00
R5394:Pik3cb UTSW 9 99088663 missense probably benign
R5769:Pik3cb UTSW 9 99093159 nonsense probably null
R6128:Pik3cb UTSW 9 99064099 missense possibly damaging 0.95
R6250:Pik3cb UTSW 9 99094598 missense probably benign 0.01
R6354:Pik3cb UTSW 9 99073643 missense probably benign 0.00
R6370:Pik3cb UTSW 9 99040934 missense probably damaging 1.00
R6664:Pik3cb UTSW 9 99094538 missense possibly damaging 0.56
R6665:Pik3cb UTSW 9 99073649 missense probably benign 0.00
R6751:Pik3cb UTSW 9 99094521 missense probably benign
R6781:Pik3cb UTSW 9 99040992 missense possibly damaging 0.52
R6869:Pik3cb UTSW 9 99060259 missense probably benign 0.08
R6883:Pik3cb UTSW 9 99101400 missense probably benign 0.00
R7150:Pik3cb UTSW 9 99093090 missense probably damaging 1.00
R7446:Pik3cb UTSW 9 99046658 missense probably damaging 1.00
R7679:Pik3cb UTSW 9 99088607 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGATCAGAAAGCACCTGG -3'
(R):5'- TAATCACGTGGTACAGCGAATG -3'

Sequencing Primer
(F):5'- CTGTCTGACATCACACCGGGTTAG -3'
(R):5'- TGTAAGCACATGACAGGCCTG -3'
Posted On2014-12-04