Incidental Mutation 'R2870:Pcdhb20'
ID253652
Institutional Source Beutler Lab
Gene Symbol Pcdhb20
Ensembl Gene ENSMUSG00000046191
Gene Nameprotocadherin beta 20
SynonymsPcdhbT, Pcdhb14
MMRRC Submission 040458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2870 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37504264-37507822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37505780 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 453 (Q453L)
Ref Sequence ENSEMBL: ENSMUSP00000137038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052179] [ENSMUST00000059571] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052179
AA Change: Q453L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137038
Gene: ENSMUSG00000046191
AA Change: Q453L

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 8.3e-36 PFAM
low complexity region 136 148 N/A INTRINSIC
CA 155 240 1.41e-19 SMART
CA 264 345 2.91e-21 SMART
CA 368 449 1.12e-22 SMART
CA 473 559 3.41e-27 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 769 7.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059571
SMART Domains Protein: ENSMUSP00000053326
Gene: ENSMUSG00000043313

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 45 131 4.8e-1 SMART
CA 155 240 6.58e-20 SMART
CA 264 345 1.03e-21 SMART
CA 368 449 4.21e-18 SMART
CA 473 559 3.36e-26 SMART
CA 589 670 6.69e-12 SMART
Pfam:Cadherin_C_2 686 769 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 94.1%
  • 20x: 79.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,379 I234N probably benign Het
Actrt3 A G 3: 30,599,698 V51A probably damaging Het
Adgb C T 10: 10,431,281 probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd10 C T 8: 11,615,682 R306H probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cacna2d1 G A 5: 16,312,568 C404Y probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Csmd3 C T 15: 47,857,924 G1437D probably damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dcp1b C T 6: 119,214,774 S217L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Dmp1 A G 5: 104,212,108 S217G probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eral1 A G 11: 78,076,278 I164T possibly damaging Het
Esr1 G A 10: 4,997,890 R481H probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gria4 T A 9: 4,503,614 N334I probably damaging Het
Grm5 T C 7: 87,602,722 V60A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ino80d C T 1: 63,061,039 probably null Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Krt31 T G 11: 100,047,873 N298T possibly damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mmp1b A T 9: 7,386,875 silent Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Mylk2 A G 2: 152,919,348 K457R probably damaging Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1080 T C 2: 86,553,584 D180G possibly damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Retnla A G 16: 48,843,612 R90G probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Spcs2 T C 7: 99,839,761 D240G probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Thbs1 C G 2: 118,119,378 N611K probably damaging Het
Tipin A C 9: 64,304,327 S232R probably benign Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Pcdhb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Pcdhb20 APN 18 37504685 missense possibly damaging 0.87
IGL01373:Pcdhb20 APN 18 37506568 missense probably benign 0.10
IGL01556:Pcdhb20 APN 18 37504799 missense possibly damaging 0.88
IGL01621:Pcdhb20 APN 18 37504807 missense possibly damaging 0.49
IGL01768:Pcdhb20 APN 18 37506715 missense possibly damaging 0.80
IGL01859:Pcdhb20 APN 18 37504563 missense probably damaging 0.98
IGL02492:Pcdhb20 APN 18 37506400 missense probably benign 0.43
IGL03057:Pcdhb20 APN 18 37504798 missense possibly damaging 0.74
IGL02991:Pcdhb20 UTSW 18 37506211 missense probably damaging 1.00
R0799:Pcdhb20 UTSW 18 37505885 missense probably damaging 1.00
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R2012:Pcdhb20 UTSW 18 37505074 missense probably damaging 0.99
R2079:Pcdhb20 UTSW 18 37505171 missense probably benign 0.07
R2350:Pcdhb20 UTSW 18 37504510 missense probably benign 0.01
R2363:Pcdhb20 UTSW 18 37505672 missense probably damaging 1.00
R2364:Pcdhb20 UTSW 18 37505938 missense probably damaging 1.00
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R4060:Pcdhb20 UTSW 18 37506164 missense probably damaging 1.00
R4609:Pcdhb20 UTSW 18 37505796 missense probably benign 0.02
R4750:Pcdhb20 UTSW 18 37506131 missense possibly damaging 0.48
R4897:Pcdhb20 UTSW 18 37506245 missense possibly damaging 0.70
R4970:Pcdhb20 UTSW 18 37506771 missense probably benign 0.00
R5098:Pcdhb20 UTSW 18 37504805 missense probably damaging 1.00
R5616:Pcdhb20 UTSW 18 37504532 missense probably damaging 0.97
R5890:Pcdhb20 UTSW 18 37505233 missense probably benign 0.00
R6225:Pcdhb20 UTSW 18 37504994 missense probably damaging 1.00
R6248:Pcdhb20 UTSW 18 37506232 missense probably damaging 0.99
R6419:Pcdhb20 UTSW 18 37505555 missense probably damaging 1.00
R6814:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R6821:Pcdhb20 UTSW 18 37506122 missense probably damaging 1.00
R6824:Pcdhb20 UTSW 18 37505699 missense probably benign 0.06
R6872:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R7040:Pcdhb20 UTSW 18 37504717 missense probably benign 0.00
R7145:Pcdhb20 UTSW 18 37505089 missense probably damaging 1.00
R7165:Pcdhb20 UTSW 18 37505070 missense probably damaging 1.00
R7215:Pcdhb20 UTSW 18 37505386 missense probably benign 0.24
R7265:Pcdhb20 UTSW 18 37505563 missense possibly damaging 0.95
R7372:Pcdhb20 UTSW 18 37506787 missense probably benign 0.00
R7402:Pcdhb20 UTSW 18 37504952 missense probably benign 0.05
R7718:Pcdhb20 UTSW 18 37505651 missense probably damaging 1.00
R7794:Pcdhb20 UTSW 18 37504432 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACGGAAGGATCCTTTGCTC -3'
(R):5'- CCCGTTGTCAGCGTTAATG -3'

Sequencing Primer
(F):5'- ACGGAAGGATCCTTTGCTCTATTCAG -3'
(R):5'- TGTCAGCGTTAATGGAGATGAGC -3'
Posted On2014-12-04