Mutagenetix > Incidental Mutations

Incidental Mutation 'R2513:Chd3'

253659

Institutional Source

Beutler Lab

Gene Symbol

Chd3

Ensembl Gene

ENSMUSG00000018474

Gene Name

chromodomain helicase DNA binding protein 3

Synonyms

Chd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1

MMRRC Submission

040419-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2513 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69343273-69369406 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69360645 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 520 (L520P)

Ref Sequence

ENSEMBL: ENSMUSP00000104301 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000144701] [ENSMUST00000154046]

Predicted Effect

probably damaging
Transcript: ENSMUST00000092971
AA Change: L520P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: L520P

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	199	253	1.4e-34	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1754	1926	8.6e-104	PFAM
low complexity region	1935	1967	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108661
AA Change: L520P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: L520P

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	100	114	N/A	INTRINSIC
low complexity region	148	180	N/A	INTRINSIC
Pfam:CHDNT	200	253	4.3e-29	PFAM
low complexity region	257	283	N/A	INTRINSIC
low complexity region	285	308	N/A	INTRINSIC
low complexity region	345	360	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	398	414	N/A	INTRINSIC
PHD	434	477	1.54e-14	SMART
RING	435	476	4.25e-1	SMART
PHD	510	553	1.74e-13	SMART
RING	511	552	3.93e0	SMART
CHROMO	558	637	7.23e-14	SMART
CHROMO	681	730	2.85e-12	SMART
low complexity region	749	755	N/A	INTRINSIC
DEXDc	784	996	1.64e-31	SMART
low complexity region	1107	1125	N/A	INTRINSIC
HELICc	1142	1226	2.61e-25	SMART
low complexity region	1290	1303	N/A	INTRINSIC
DUF1087	1345	1409	2.98e-33	SMART
DUF1086	1415	1571	1.79e-109	SMART
low complexity region	1573	1602	N/A	INTRINSIC
low complexity region	1672	1685	N/A	INTRINSIC
Pfam:CHDCT2	1789	1960	4.9e-93	PFAM
low complexity region	1969	2001	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000128981
AA Change: L426P

SMART Domains

Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: L426P

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	55	87	N/A	INTRINSIC
Pfam:CHDNT	107	160	3.9e-29	PFAM
low complexity region	164	190	N/A	INTRINSIC
low complexity region	192	215	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
low complexity region	274	283	N/A	INTRINSIC
low complexity region	305	321	N/A	INTRINSIC
PHD	341	384	1.54e-14	SMART
RING	342	383	4.25e-1	SMART
PHD	417	460	1.74e-13	SMART
RING	418	459	3.93e0	SMART
CHROMO	465	544	7.23e-14	SMART
CHROMO	588	637	2.85e-12	SMART
low complexity region	656	662	N/A	INTRINSIC
DEXDc	691	903	1.64e-31	SMART
low complexity region	1014	1032	N/A	INTRINSIC
HELICc	1049	1133	2.61e-25	SMART
low complexity region	1197	1210	N/A	INTRINSIC
DUF1087	1252	1316	2.98e-33	SMART
DUF1086	1322	1478	1.79e-109	SMART
low complexity region	1480	1509	N/A	INTRINSIC
low complexity region	1579	1592	N/A	INTRINSIC
Pfam:CHDCT2	1662	1833	4.4e-93	PFAM
low complexity region	1842	1874	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144701

SMART Domains

Protein: ENSMUSP00000114520
Gene: ENSMUSG00000018474

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
low complexity region	23	32	N/A	INTRINSIC
low complexity region	52	67	N/A	INTRINSIC
PHD	84	127	1.54e-14	SMART
RING	85	126	4.25e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151436

SMART Domains

Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474

Domain	Start	End	E-Value	Type
Pfam:SNF2_N	1	142	9e-24	PFAM
SCOP:d1gkub2	162	197	1e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000154046

SMART Domains

Protein: ENSMUSP00000121192
Gene: ENSMUSG00000018474

Domain	Start	End	E-Value	Type
low complexity region	1	29	N/A	INTRINSIC
low complexity region	50	66	N/A	INTRINSIC
PHD	86	129	1.54e-14	SMART
RING	87	128	4.25e-1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,661,852	T719A	possibly damaging	Het
9530053A07Rik	C	G	7: 28,131,635	S91C	probably damaging	Het
Abcc1	A	G	16: 14,473,009		probably null	Het
Aftph	C	T	11: 20,708,676		probably null	Het
Als2	C	A	1: 59,215,117	K360N	probably benign	Het
Atg2a	T	A	19: 6,258,046		probably null	Het
Axl	T	C	7: 25,787,516	D22G	probably benign	Het
Baiap2	G	A	11: 119,999,226	A438T	probably benign	Het
Bean1	G	C	8: 104,182,011	A7P	probably benign	Het
Birc6	C	G	17: 74,647,729	P3431R	probably damaging	Het
Camk1d	A	G	2: 5,714,236	M1T	probably null	Het
Carmil3	T	C	14: 55,503,838	Y1027H	probably damaging	Het
Ccdc6	G	A	10: 70,187,828		probably benign	Het
Cemip	C	A	7: 83,942,025	V1280L	probably benign	Het
Cfap58	C	A	19: 47,962,542	N447K	probably benign	Het
Col1a2	T	A	6: 4,531,223		probably null	Het
Cpne7	A	C	8: 123,117,667		probably null	Het
Ctla4	T	C	1: 60,912,564	V84A	probably damaging	Het
Dap3	A	G	3: 88,928,258	V263A	probably benign	Het
Dhx57	T	A	17: 80,241,949		probably null	Het
Dlg5	C	A	14: 24,164,525	K663N	probably damaging	Het
Dsg3	C	A	18: 20,523,662	F196L	possibly damaging	Het
Eif2ak4	C	A	2: 118,426,583	D402E	probably damaging	Het
Fam208b	G	T	13: 3,582,150	L784I	possibly damaging	Het
Fance	T	C	17: 28,318,094	V24A	probably benign	Het
Fasn	A	T	11: 120,814,748	L1149Q	probably damaging	Het
Flg	T	A	3: 93,279,786	S182T	possibly damaging	Het
Gm128	T	A	3: 95,239,982	S334C	possibly damaging	Het
Gm3727	A	C	14: 7,264,561	H31Q	probably damaging	Het
Gm4841	T	G	18: 60,270,905	T39P	probably damaging	Het
Golgb1	G	T	16: 36,915,151	V1587L	possibly damaging	Het
Golm1	G	A	13: 59,642,258	P243S	probably benign	Het
Gstcd	C	A	3: 133,082,320	A206S	possibly damaging	Het
Gstcd	C	A	3: 133,082,321	K205N	possibly damaging	Het
Gtf3c1	A	G	7: 125,681,173	V355A	probably benign	Het
Hhatl	T	C	9: 121,789,170	D173G	probably benign	Het
Kcnu1	T	A	8: 25,905,966	C660S	probably benign	Het
Kctd8	T	C	5: 69,110,645	D374G	probably benign	Het
Kif21a	T	C	15: 90,994,391	I229V	possibly damaging	Het
L3mbtl1	A	T	2: 162,967,585	I702F	probably benign	Het
Lce1d	T	C	3: 92,685,759		probably benign	Het
Lrig1	C	T	6: 94,617,366		probably null	Het
Lrp12	A	T	15: 39,876,111	D563E	probably damaging	Het
Lrp2	C	T	2: 69,506,374		probably null	Het
Map3k5	G	A	10: 20,094,455	V703I	possibly damaging	Het
Mecr	A	G	4: 131,853,765	R110G	probably benign	Het
Mtrr	T	A	13: 68,566,973	K445*	probably null	Het
Nanos1	T	A	19: 60,756,552	L96Q	probably benign	Het
Olfr538	T	G	7: 140,574,156	M1R	probably null	Het
Olfr574	T	A	7: 102,949,493	F333I	probably benign	Het
Olfr807	T	A	10: 129,755,152	L99F	probably damaging	Het
Otog	T	C	7: 46,305,590		probably null	Het
Pcdhb3	T	A	18: 37,301,239	L86*	probably null	Het
Pcdhb3	A	T	18: 37,301,240	L86F	probably damaging	Het
Pcdhb3	G	T	18: 37,301,241	V87F	probably benign	Het
Pdgfd	A	G	9: 6,359,894	K322E	probably damaging	Het
Picalm	T	C	7: 90,197,009	S648P	probably damaging	Het
Pigr	T	C	1: 130,846,620	S446P	possibly damaging	Het
Pik3cb	A	C	9: 99,061,842	L636W	probably damaging	Het
Pla2g2f	A	T	4: 138,754,162	L92Q	probably damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Prkar2b	C	T	12: 31,975,929	V191I	possibly damaging	Het
Prune1	C	A	3: 95,258,119	A281S	probably benign	Het
Ptges3l	A	T	11: 101,424,042	C42S	possibly damaging	Het
Reg3b	A	T	6: 78,371,819	I33L	probably benign	Het
Rel	A	G	11: 23,745,823	I188T	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Ripor1	G	T	8: 105,617,622	V463L	probably benign	Het
Rrm1	T	A	7: 102,460,689	D510E	probably damaging	Het
Setd7	A	G	3: 51,533,015	S202P	probably damaging	Het
Shank3	T	A	15: 89,548,686	D1211E	probably benign	Het
Slc30a1	A	T	1: 191,907,562	T186S	possibly damaging	Het
Slc4a4	G	A	5: 89,156,398	V523I	probably benign	Het
Slc9a2	T	A	1: 40,742,608		probably null	Het
Smg6	A	G	11: 74,929,676	T258A	probably damaging	Het
Sptlc1	C	T	13: 53,337,640	D408N	possibly damaging	Het
Tbl3	T	C	17: 24,704,550		probably null	Het
Tdo2	T	C	3: 81,969,505	D139G	possibly damaging	Het
Ticam1	T	A	17: 56,271,612	H161L	possibly damaging	Het
Tnfaip3	T	A	10: 19,005,659	D293V	probably benign	Het
Trim72	G	A	7: 128,004,706	V75M	possibly damaging	Het
Trip11	T	A	12: 101,837,727	N1632I	possibly damaging	Het
Tspan18	A	T	2: 93,220,095	M61K	possibly damaging	Het
Tuba8	A	T	6: 121,225,973	E415V	probably damaging	Het
Ung	A	G	5: 114,137,192	H214R	probably benign	Het
Uqcrc1	T	C	9: 108,936,768	L17P	probably damaging	Het
Usp24	A	G	4: 106,379,405		probably null	Het
Vps39	A	C	2: 120,338,787	Y245D	probably damaging	Het
Whrn	T	A	4: 63,435,412	T373S	probably benign	Het
Zc2hc1a	C	T	3: 7,516,536		probably null	Het

Other mutations in Chd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Chd3	APN	11	69357062	missense	probably damaging	0.96
IGL00551:Chd3	APN	11	69346629	missense	probably damaging	1.00
IGL00661:Chd3	APN	11	69357383	missense	possibly damaging	0.84
IGL00698:Chd3	APN	11	69349871	missense	probably damaging	0.98
IGL01075:Chd3	APN	11	69359965	missense	probably damaging	1.00
IGL01309:Chd3	APN	11	69357731	missense	probably damaging	0.99
IGL01317:Chd3	APN	11	69353211	missense	probably damaging	1.00
IGL01374:Chd3	APN	11	69359980	missense	probably damaging	0.99
IGL01444:Chd3	APN	11	69348742	missense	probably benign	0.28
IGL01617:Chd3	APN	11	69358234	unclassified	probably benign
IGL01635:Chd3	APN	11	69361250	splice site	probably benign
IGL01942:Chd3	APN	11	69350105	critical splice donor site	probably null
IGL01962:Chd3	APN	11	69357493	missense	possibly damaging	0.46
IGL01981:Chd3	APN	11	69360675	missense	probably damaging	0.99
IGL02022:Chd3	APN	11	69361060	missense	probably damaging	1.00
IGL02098:Chd3	APN	11	69359829	missense	probably damaging	1.00
IGL02218:Chd3	APN	11	69352094	unclassified	probably benign
IGL02415:Chd3	APN	11	69348913	splice site	probably benign
IGL02648:Chd3	APN	11	69352150	missense	probably damaging	1.00
IGL02951:Chd3	APN	11	69361048	critical splice donor site	probably null
IGL03030:Chd3	APN	11	69354404	missense	possibly damaging	0.64
IGL03102:Chd3	APN	11	69361196	nonsense	probably null
IGL03168:Chd3	APN	11	69348915	splice site	probably benign
IGL03327:Chd3	APN	11	69350186	missense	probably damaging	1.00
burg	UTSW	11	69356554	missense	probably damaging	1.00
Fortress	UTSW	11	69364050	nonsense	probably null
Redoubt	UTSW	11	69353901	unclassified	probably benign
schloss	UTSW	11	69362060	nonsense	probably null
R0009:Chd3	UTSW	11	69349906	missense	probably damaging	0.99
R0009:Chd3	UTSW	11	69349906	missense	probably damaging	0.99
R0056:Chd3	UTSW	11	69359913	unclassified	probably benign
R0129:Chd3	UTSW	11	69348501	nonsense	probably null
R0130:Chd3	UTSW	11	69359830	missense	probably damaging	1.00
R0309:Chd3	UTSW	11	69357018	missense	probably damaging	1.00
R0330:Chd3	UTSW	11	69356333	missense	probably damaging	1.00
R0449:Chd3	UTSW	11	69357541	missense	probably damaging	0.98
R0502:Chd3	UTSW	11	69354105	missense	probably damaging	0.98
R0540:Chd3	UTSW	11	69344358	missense	probably damaging	0.98
R0571:Chd3	UTSW	11	69361669	critical splice donor site	probably null
R0607:Chd3	UTSW	11	69344358	missense	probably damaging	0.98
R0616:Chd3	UTSW	11	69345487	missense	probably damaging	0.96
R0630:Chd3	UTSW	11	69347195	missense	probably damaging	1.00
R1436:Chd3	UTSW	11	69357574	splice site	probably null
R1484:Chd3	UTSW	11	69359899	missense	probably benign	0.17
R1741:Chd3	UTSW	11	69355654	missense	probably damaging	1.00
R1748:Chd3	UTSW	11	69364697	missense	possibly damaging	0.81
R1751:Chd3	UTSW	11	69353901	unclassified	probably benign
R1833:Chd3	UTSW	11	69354123	missense	probably damaging	1.00
R2012:Chd3	UTSW	11	69349052	missense	probably benign	0.01
R2101:Chd3	UTSW	11	69349051	missense	probably benign
R2147:Chd3	UTSW	11	69349028	missense	probably benign	0.00
R2877:Chd3	UTSW	11	69361172	nonsense	probably null
R2879:Chd3	UTSW	11	69364098	missense	possibly damaging	0.52
R2880:Chd3	UTSW	11	69352120	missense	probably damaging	1.00
R2881:Chd3	UTSW	11	69352120	missense	probably damaging	1.00
R2973:Chd3	UTSW	11	69360616	missense	probably damaging	1.00
R3611:Chd3	UTSW	11	69362147	missense	possibly damaging	0.53
R3743:Chd3	UTSW	11	69364050	nonsense	probably null
R3845:Chd3	UTSW	11	69346759	missense	possibly damaging	0.65
R3889:Chd3	UTSW	11	69359185	missense	probably damaging	0.98
R4007:Chd3	UTSW	11	69349001	missense	probably benign
R4115:Chd3	UTSW	11	69357517	missense	possibly damaging	0.95
R4515:Chd3	UTSW	11	69349877	missense	probably benign	0.00
R4612:Chd3	UTSW	11	69353209	nonsense	probably null
R4622:Chd3	UTSW	11	69349008	missense	probably damaging	0.98
R4634:Chd3	UTSW	11	69362187	unclassified	probably benign
R4635:Chd3	UTSW	11	69362187	unclassified	probably benign
R4859:Chd3	UTSW	11	69359896	missense	possibly damaging	0.79
R4930:Chd3	UTSW	11	69354208	unclassified	probably benign
R5173:Chd3	UTSW	11	69369243	unclassified	probably benign
R5287:Chd3	UTSW	11	69349069	splice site	probably null
R5403:Chd3	UTSW	11	69349069	splice site	probably null
R5511:Chd3	UTSW	11	69361475	missense	probably damaging	1.00
R5666:Chd3	UTSW	11	69353351	missense	possibly damaging	0.83
R5702:Chd3	UTSW	11	69361435	missense	possibly damaging	0.46
R6045:Chd3	UTSW	11	69352118	missense	possibly damaging	0.90
R6063:Chd3	UTSW	11	69349237	missense	probably benign
R6211:Chd3	UTSW	11	69352677	missense	probably damaging	1.00
R6215:Chd3	UTSW	11	69356554	missense	probably damaging	1.00
R6217:Chd3	UTSW	11	69345535	missense	probably damaging	1.00
R6302:Chd3	UTSW	11	69353778	missense	probably damaging	0.98
R6329:Chd3	UTSW	11	69361684	missense	possibly damaging	0.70
R6349:Chd3	UTSW	11	69364031	missense	possibly damaging	0.50
R6414:Chd3	UTSW	11	69352545	critical splice donor site	probably null
R6453:Chd3	UTSW	11	69350112	nonsense	probably null
R6548:Chd3	UTSW	11	69362060	nonsense	probably null
R6582:Chd3	UTSW	11	69369156	unclassified	probably benign
R6721:Chd3	UTSW	11	69369219	unclassified	probably benign
R6776:Chd3	UTSW	11	69354470	missense	probably damaging	1.00
R6900:Chd3	UTSW	11	69354445	missense	possibly damaging	0.64
R7085:Chd3	UTSW	11	69369201	missense	unknown
R7136:Chd3	UTSW	11	69348438	missense	probably null	0.37
R7164:Chd3	UTSW	11	69362306	missense	probably damaging	1.00
R7200:Chd3	UTSW	11	69364095	missense	possibly damaging	0.94
R7226:Chd3	UTSW	11	69369211	missense	unknown
R7238:Chd3	UTSW	11	69364047	missense	probably benign	0.31
R7316:Chd3	UTSW	11	69345568	missense	probably damaging	0.99
R7560:Chd3	UTSW	11	69356270	missense	probably damaging	1.00
R7684:Chd3	UTSW	11	69357866	missense	possibly damaging	0.83
R7748:Chd3	UTSW	11	69355633	missense	probably benign	0.00
R7820:Chd3	UTSW	11	69353238	missense	probably damaging	1.00
X0022:Chd3	UTSW	11	69356258	missense	probably damaging	1.00
X0062:Chd3	UTSW	11	69354445	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- AGGACGAGCTGGTTGGTATC -3'
(R):5'- CCAGGAGACTTATGCACATCTG -3'

Sequencing Primer
(F):5'- CTGGGCCTCAGAAATGGGTG -3'
(R):5'- AGACTTATGCACATCTGGGGCTC -3'

Posted On

2014-12-04