Incidental Mutation 'R2871:Hjurp'
ID 253666
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene Name Holliday junction recognition protein
Synonyms A730008H23Rik, C330011F01Rik, 6430706D22Rik
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # R2871 (G1)
Quality Score 202
Status Not validated
Chromosome 1
Chromosomal Location 88190193-88205355 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) GT to GTT at 88194246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88,197,991 (GRCm39) missense probably benign 0.04
IGL03099:Hjurp APN 1 88,194,011 (GRCm39) missense probably benign 0.09
BB003:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
IGL03097:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
PIT4142001:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
PIT4378001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R0053:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0371:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R0442:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R0762:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0928:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1333:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
R1342:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R1364:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R1496:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88,193,843 (GRCm39) missense probably benign 0.03
R1905:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
R1965:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1992:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2002:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2023:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2024:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2332:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R2420:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2422:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R2869:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2870:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2872:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3019:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3021:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3150:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R3411:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3552:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3704:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3730:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3733:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3764:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3799:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3819:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3857:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3930:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3952:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4090:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4159:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4207:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4322:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4391:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4392:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4397:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4700:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4808:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4900:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4901:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5023:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5123:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5300:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5318:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5370:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5410:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5445:Hjurp UTSW 1 88,194,038 (GRCm39) missense probably benign 0.43
R5457:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R5497:Hjurp UTSW 1 88,194,042 (GRCm39) missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5561:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5615:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5661:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R5722:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6087:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6089:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6090:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6125:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6175:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6362:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R7016:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7016:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7045:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7179:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7200:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7463:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7912:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R8215:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R8968:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9038:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R9115:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9133:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R9146:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9221:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9475:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9482:Hjurp UTSW 1 88,193,996 (GRCm39) utr 3 prime probably benign
R9565:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9599:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
V5622:Hjurp UTSW 1 88,205,247 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- AAACTGTCATGGTTTGTGATGC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'
Posted On 2014-12-04