Incidental Mutation 'R2513:Baiap2'
ID253669
Institutional Source Beutler Lab
Gene Symbol Baiap2
Ensembl Gene ENSMUSG00000025372
Gene Namebrain-specific angiogenesis inhibitor 1-associated protein 2
SynonymsIRSp53
MMRRC Submission 040419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R2513 (G1)
Quality Score143
Status Not validated
Chromosome11
Chromosomal Location119942763-120006782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119999226 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 438 (A438T)
Ref Sequence ENSEMBL: ENSMUSP00000099310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026436] [ENSMUST00000075180] [ENSMUST00000103021] [ENSMUST00000106231] [ENSMUST00000106233]
Predicted Effect probably benign
Transcript: ENSMUST00000026436
AA Change: A478T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026436
Gene: ENSMUSG00000025372
AA Change: A478T

DomainStartEndE-ValueType
Pfam:IMD 17 237 6e-101 PFAM
PDB:4JS0|B 261 292 2e-13 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075180
AA Change: A478T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074674
Gene: ENSMUSG00000025372
AA Change: A478T

DomainStartEndE-ValueType
Pfam:IMD 17 237 3e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103021
AA Change: A438T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099310
Gene: ENSMUSG00000025372
AA Change: A438T

DomainStartEndE-ValueType
Pfam:IMD 17 237 2.5e-98 PFAM
PDB:4JS0|B 261 292 2e-12 PDB
SH3 338 397 9.77e-11 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 470 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106231
AA Change: A478T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101838
Gene: ENSMUSG00000025372
AA Change: A478T

DomainStartEndE-ValueType
Pfam:IMD 17 237 6.4e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106233
AA Change: A478T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101840
Gene: ENSMUSG00000025372
AA Change: A478T

DomainStartEndE-ValueType
Pfam:IMD 17 237 1.6e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131580
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been identified as a brain-specific angiogenesis inhibitor (BAI1)-binding protein. This adaptor protein links membrane bound G-proteins to cytoplasmic effector proteins. This protein functions as an insulin receptor tyrosine kinase substrate and suggests a role for insulin in the central nervous system. It also associates with a downstream effector of Rho small G proteins, which is associated with the formation of stress fibers and cytokinesis. This protein is involved in lamellipodia and filopodia formation in motile cells and may affect neuronal growth-cone guidance. This protein has also been identified as interacting with the dentatorubral-pallidoluysian atrophy gene, which is associated with an autosomal dominant neurodegenerative disease. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mice show enhanced NMDA receptor-mediated synaptic transmission, enhanced long-term potentiation, and impaired learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,661,852 T719A possibly damaging Het
9530053A07Rik C G 7: 28,131,635 S91C probably damaging Het
Abcc1 A G 16: 14,473,009 probably null Het
Aftph C T 11: 20,708,676 probably null Het
Als2 C A 1: 59,215,117 K360N probably benign Het
Atg2a T A 19: 6,258,046 probably null Het
Axl T C 7: 25,787,516 D22G probably benign Het
Bean1 G C 8: 104,182,011 A7P probably benign Het
Birc6 C G 17: 74,647,729 P3431R probably damaging Het
Camk1d A G 2: 5,714,236 M1T probably null Het
Carmil3 T C 14: 55,503,838 Y1027H probably damaging Het
Ccdc6 G A 10: 70,187,828 probably benign Het
Cemip C A 7: 83,942,025 V1280L probably benign Het
Cfap58 C A 19: 47,962,542 N447K probably benign Het
Chd3 A G 11: 69,360,645 L520P probably damaging Het
Col1a2 T A 6: 4,531,223 probably null Het
Cpne7 A C 8: 123,117,667 probably null Het
Ctla4 T C 1: 60,912,564 V84A probably damaging Het
Dap3 A G 3: 88,928,258 V263A probably benign Het
Dhx57 T A 17: 80,241,949 probably null Het
Dlg5 C A 14: 24,164,525 K663N probably damaging Het
Dsg3 C A 18: 20,523,662 F196L possibly damaging Het
Eif2ak4 C A 2: 118,426,583 D402E probably damaging Het
Fam208b G T 13: 3,582,150 L784I possibly damaging Het
Fance T C 17: 28,318,094 V24A probably benign Het
Fasn A T 11: 120,814,748 L1149Q probably damaging Het
Flg T A 3: 93,279,786 S182T possibly damaging Het
Gm128 T A 3: 95,239,982 S334C possibly damaging Het
Gm3727 A C 14: 7,264,561 H31Q probably damaging Het
Gm4841 T G 18: 60,270,905 T39P probably damaging Het
Golgb1 G T 16: 36,915,151 V1587L possibly damaging Het
Golm1 G A 13: 59,642,258 P243S probably benign Het
Gstcd C A 3: 133,082,320 A206S possibly damaging Het
Gstcd C A 3: 133,082,321 K205N possibly damaging Het
Gtf3c1 A G 7: 125,681,173 V355A probably benign Het
Hhatl T C 9: 121,789,170 D173G probably benign Het
Kcnu1 T A 8: 25,905,966 C660S probably benign Het
Kctd8 T C 5: 69,110,645 D374G probably benign Het
Kif21a T C 15: 90,994,391 I229V possibly damaging Het
L3mbtl1 A T 2: 162,967,585 I702F probably benign Het
Lce1d T C 3: 92,685,759 probably benign Het
Lrig1 C T 6: 94,617,366 probably null Het
Lrp12 A T 15: 39,876,111 D563E probably damaging Het
Lrp2 C T 2: 69,506,374 probably null Het
Map3k5 G A 10: 20,094,455 V703I possibly damaging Het
Mecr A G 4: 131,853,765 R110G probably benign Het
Mtrr T A 13: 68,566,973 K445* probably null Het
Nanos1 T A 19: 60,756,552 L96Q probably benign Het
Olfr538 T G 7: 140,574,156 M1R probably null Het
Olfr574 T A 7: 102,949,493 F333I probably benign Het
Olfr807 T A 10: 129,755,152 L99F probably damaging Het
Otog T C 7: 46,305,590 probably null Het
Pcdhb3 T A 18: 37,301,239 L86* probably null Het
Pcdhb3 A T 18: 37,301,240 L86F probably damaging Het
Pcdhb3 G T 18: 37,301,241 V87F probably benign Het
Pdgfd A G 9: 6,359,894 K322E probably damaging Het
Picalm T C 7: 90,197,009 S648P probably damaging Het
Pigr T C 1: 130,846,620 S446P possibly damaging Het
Pik3cb A C 9: 99,061,842 L636W probably damaging Het
Pla2g2f A T 4: 138,754,162 L92Q probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prkar2b C T 12: 31,975,929 V191I possibly damaging Het
Prune1 C A 3: 95,258,119 A281S probably benign Het
Ptges3l A T 11: 101,424,042 C42S possibly damaging Het
Reg3b A T 6: 78,371,819 I33L probably benign Het
Rel A G 11: 23,745,823 I188T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor1 G T 8: 105,617,622 V463L probably benign Het
Rrm1 T A 7: 102,460,689 D510E probably damaging Het
Setd7 A G 3: 51,533,015 S202P probably damaging Het
Shank3 T A 15: 89,548,686 D1211E probably benign Het
Slc30a1 A T 1: 191,907,562 T186S possibly damaging Het
Slc4a4 G A 5: 89,156,398 V523I probably benign Het
Slc9a2 T A 1: 40,742,608 probably null Het
Smg6 A G 11: 74,929,676 T258A probably damaging Het
Sptlc1 C T 13: 53,337,640 D408N possibly damaging Het
Tbl3 T C 17: 24,704,550 probably null Het
Tdo2 T C 3: 81,969,505 D139G possibly damaging Het
Ticam1 T A 17: 56,271,612 H161L possibly damaging Het
Tnfaip3 T A 10: 19,005,659 D293V probably benign Het
Trim72 G A 7: 128,004,706 V75M possibly damaging Het
Trip11 T A 12: 101,837,727 N1632I possibly damaging Het
Tspan18 A T 2: 93,220,095 M61K possibly damaging Het
Tuba8 A T 6: 121,225,973 E415V probably damaging Het
Ung A G 5: 114,137,192 H214R probably benign Het
Uqcrc1 T C 9: 108,936,768 L17P probably damaging Het
Usp24 A G 4: 106,379,405 probably null Het
Vps39 A C 2: 120,338,787 Y245D probably damaging Het
Whrn T A 4: 63,435,412 T373S probably benign Het
Zc2hc1a C T 3: 7,516,536 probably null Het
Other mutations in Baiap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Baiap2 APN 11 119982010 missense probably benign
IGL00574:Baiap2 APN 11 120006408 missense probably damaging 0.99
IGL00960:Baiap2 APN 11 119999292 missense possibly damaging 0.78
PIT4480001:Baiap2 UTSW 11 119997087 missense probably benign
R0637:Baiap2 UTSW 11 120000579 missense probably benign 0.00
R1682:Baiap2 UTSW 11 119997540 missense probably damaging 0.98
R2138:Baiap2 UTSW 11 119957102 missense possibly damaging 0.78
R4924:Baiap2 UTSW 11 119997024 missense probably damaging 1.00
R5389:Baiap2 UTSW 11 119996670 missense probably damaging 1.00
R5576:Baiap2 UTSW 11 119996911 missense probably benign 0.05
R6235:Baiap2 UTSW 11 119981408 missense probably damaging 1.00
R6966:Baiap2 UTSW 11 120006405 nonsense probably null
R7252:Baiap2 UTSW 11 120003039 missense probably benign
RF005:Baiap2 UTSW 11 119996529 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTATGTACAGCACAGGAACC -3'
(R):5'- AGAAAGGTCGTGCACAGACTC -3'

Sequencing Primer
(F):5'- CCTGGCAGGGAGGTTAGAC -3'
(R):5'- AGACTCAGTCTGGTAAGGTGTGAG -3'
Posted On2014-12-04