Incidental Mutation 'R2871:Pkp4'
ID 253677
Institutional Source Beutler Lab
Gene Symbol Pkp4
Ensembl Gene ENSMUSG00000026991
Gene Name plakophilin 4
Synonyms p0071, 5031422I09Rik, Armrp, 9430019K17Rik
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 58991194-59185552 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 59138500 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 250 (T250K)
Ref Sequence ENSEMBL: ENSMUSP00000122152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037903] [ENSMUST00000102754] [ENSMUST00000112577] [ENSMUST00000123908] [ENSMUST00000168631] [ENSMUST00000183359] [ENSMUST00000184332] [ENSMUST00000184705]
AlphaFold Q68FH0
Predicted Effect probably benign
Transcript: ENSMUST00000037903
AA Change: T250K

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042249
Gene: ENSMUSG00000026991
AA Change: T250K

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
ARM 876 916 3.34e-6 SMART
ARM 964 1008 1.32e-4 SMART
low complexity region 1057 1073 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102754
AA Change: T250K

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099815
Gene: ENSMUSG00000026991
AA Change: T250K

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1083 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112577
SMART Domains Protein: ENSMUSP00000108196
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
low complexity region 126 137 N/A INTRINSIC
ARM 217 257 5.68e-9 SMART
ARM 261 302 1.61e-8 SMART
ARM 303 360 4.54e1 SMART
ARM 362 409 9.97e0 SMART
low complexity region 420 431 N/A INTRINSIC
ARM 519 559 3.34e-6 SMART
ARM 607 651 1.32e-4 SMART
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123908
AA Change: T250K

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122152
Gene: ENSMUSG00000026991
AA Change: T250K

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124725
Predicted Effect probably benign
Transcript: ENSMUST00000168631
AA Change: T250K

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129836
Gene: ENSMUSG00000026991
AA Change: T250K

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1041 1057 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183359
SMART Domains Protein: ENSMUSP00000139141
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183625
Predicted Effect probably benign
Transcript: ENSMUST00000184332
Predicted Effect probably benign
Transcript: ENSMUST00000184705
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo-like proteins are characterized by a series of armadillo repeats, first defined in the Drosophila 'armadillo' gene product, that are typically 42 to 45 amino acids in length. These proteins can be divided into subfamilies based on their number of repeats, their overall sequence similarity, and the dispersion of the repeats throughout their sequences. Members of the p120(ctn)/plakophilin subfamily of Armadillo-like proteins, including CTNND1, CTNND2, PKP1, PKP2, PKP4, and ARVCF. PKP4 may be a component of desmosomal plaque and other adhesion plaques and is thought to be involved in regulating junctional plaque organization and cadherin function. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype during the observation period early in life, although abnormalities may still develop at older age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Pkp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pkp4 APN 2 59,169,099 (GRCm39) missense probably damaging 0.99
IGL00987:Pkp4 APN 2 59,138,701 (GRCm39) missense probably damaging 0.98
IGL01321:Pkp4 APN 2 59,180,971 (GRCm39) splice site probably null
IGL01393:Pkp4 APN 2 59,178,269 (GRCm39) missense probably damaging 1.00
IGL02058:Pkp4 APN 2 59,142,073 (GRCm39) nonsense probably null
IGL02313:Pkp4 APN 2 59,140,598 (GRCm39) nonsense probably null
IGL02635:Pkp4 APN 2 59,135,842 (GRCm39) unclassified probably benign
IGL03017:Pkp4 APN 2 59,096,769 (GRCm39) missense probably benign 0.06
IGL03051:Pkp4 APN 2 59,142,106 (GRCm39) missense probably benign 0.29
Degrasso UTSW 2 59,148,944 (GRCm39) missense probably damaging 1.00
melted UTSW 2 59,165,276 (GRCm39) critical splice donor site probably null
BB004:Pkp4 UTSW 2 59,142,098 (GRCm39) missense probably damaging 0.97
BB014:Pkp4 UTSW 2 59,142,098 (GRCm39) missense probably damaging 0.97
R0206:Pkp4 UTSW 2 59,096,780 (GRCm39) missense probably damaging 0.99
R0207:Pkp4 UTSW 2 59,135,832 (GRCm39) missense possibly damaging 0.89
R0208:Pkp4 UTSW 2 59,096,780 (GRCm39) missense probably damaging 0.99
R0325:Pkp4 UTSW 2 59,148,873 (GRCm39) missense probably damaging 1.00
R0620:Pkp4 UTSW 2 59,152,987 (GRCm39) missense possibly damaging 0.46
R0781:Pkp4 UTSW 2 59,169,109 (GRCm39) missense probably damaging 1.00
R1110:Pkp4 UTSW 2 59,169,109 (GRCm39) missense probably damaging 1.00
R1537:Pkp4 UTSW 2 59,045,147 (GRCm39) missense probably damaging 1.00
R1607:Pkp4 UTSW 2 59,152,898 (GRCm39) missense probably benign 0.00
R1654:Pkp4 UTSW 2 59,167,963 (GRCm39) missense probably damaging 0.96
R1760:Pkp4 UTSW 2 59,142,185 (GRCm39) missense probably damaging 0.97
R2051:Pkp4 UTSW 2 59,165,248 (GRCm39) missense probably benign 0.37
R2871:Pkp4 UTSW 2 59,138,500 (GRCm39) missense probably benign 0.35
R3161:Pkp4 UTSW 2 59,138,449 (GRCm39) missense probably damaging 1.00
R4261:Pkp4 UTSW 2 59,135,506 (GRCm39) missense probably damaging 1.00
R4342:Pkp4 UTSW 2 59,180,952 (GRCm39) missense probably damaging 0.98
R4731:Pkp4 UTSW 2 59,165,276 (GRCm39) critical splice donor site probably null
R4799:Pkp4 UTSW 2 59,172,449 (GRCm39) missense probably damaging 1.00
R4913:Pkp4 UTSW 2 59,135,794 (GRCm39) missense probably damaging 1.00
R5383:Pkp4 UTSW 2 59,140,617 (GRCm39) nonsense probably null
R5418:Pkp4 UTSW 2 59,140,506 (GRCm39) missense probably benign 0.09
R5906:Pkp4 UTSW 2 59,135,420 (GRCm39) missense possibly damaging 0.79
R5946:Pkp4 UTSW 2 59,135,411 (GRCm39) missense probably benign 0.01
R6360:Pkp4 UTSW 2 59,045,091 (GRCm39) missense probably benign 0.01
R6616:Pkp4 UTSW 2 59,180,896 (GRCm39) nonsense probably null
R6817:Pkp4 UTSW 2 59,148,944 (GRCm39) missense probably damaging 1.00
R7390:Pkp4 UTSW 2 59,140,484 (GRCm39) missense possibly damaging 0.94
R7408:Pkp4 UTSW 2 59,142,110 (GRCm39) missense probably damaging 1.00
R7464:Pkp4 UTSW 2 59,138,481 (GRCm39) missense probably benign 0.12
R7702:Pkp4 UTSW 2 59,138,757 (GRCm39) missense probably damaging 0.99
R7787:Pkp4 UTSW 2 59,152,881 (GRCm39) missense probably damaging 0.98
R7927:Pkp4 UTSW 2 59,142,098 (GRCm39) missense probably damaging 0.97
R8055:Pkp4 UTSW 2 59,138,359 (GRCm39) missense probably benign
R8359:Pkp4 UTSW 2 59,180,895 (GRCm39) missense probably damaging 1.00
R8465:Pkp4 UTSW 2 59,172,525 (GRCm39) missense possibly damaging 0.90
R8555:Pkp4 UTSW 2 59,138,379 (GRCm39) nonsense probably null
R8909:Pkp4 UTSW 2 59,184,758 (GRCm39) missense possibly damaging 0.71
R9224:Pkp4 UTSW 2 59,144,738 (GRCm39) missense probably benign 0.41
R9397:Pkp4 UTSW 2 59,148,856 (GRCm39) nonsense probably null
R9486:Pkp4 UTSW 2 59,138,722 (GRCm39) missense probably benign 0.27
R9583:Pkp4 UTSW 2 59,178,104 (GRCm39) missense possibly damaging 0.80
R9732:Pkp4 UTSW 2 59,138,797 (GRCm39) missense possibly damaging 0.94
Z1176:Pkp4 UTSW 2 59,172,588 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCCCTGGATAAACCCGTTCTC -3'
(R):5'- TACTCGAGTCTGGGCATCAGTC -3'

Sequencing Primer
(F):5'- CTGGATAAACCCGTTCTCTTTTC -3'
(R):5'- GCATCAGTCAGGGTCAGTG -3'
Posted On 2014-12-04