Incidental Mutation 'R0314:Uba6'
ID25368
Institutional Source Beutler Lab
Gene Symbol Uba6
Ensembl Gene ENSMUSG00000035898
Gene Nameubiquitin-like modifier activating enzyme 6
SynonymsUbe1l2, 5730469D23Rik
MMRRC Submission 038524-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0314 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location86109287-86172803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86118087 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 956 (V956E)
Ref Sequence ENSEMBL: ENSMUSP00000109000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039373] [ENSMUST00000113373]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039373
AA Change: V987E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035328
Gene: ENSMUSG00000035898
AA Change: V987E

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Pfam:ThiF 44 431 8.9e-29 PFAM
Pfam:E1_FCCH 224 293 1.7e-28 PFAM
Pfam:E1_4HB 294 362 9.8e-21 PFAM
internal_repeat_1 443 588 1.25e-6 PROSPERO
Pfam:UBA_e1_thiolCys 631 884 3.7e-80 PFAM
UBA_e1_C 921 1043 1.04e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113373
AA Change: V956E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109000
Gene: ENSMUSG00000035898
AA Change: V956E

DomainStartEndE-ValueType
Pfam:ThiF 29 167 1.8e-16 PFAM
Pfam:ThiF 428 573 8.5e-34 PFAM
Pfam:UBA_e1_thiolCys 575 619 2.3e-22 PFAM
Pfam:UBACT 817 885 2.9e-28 PFAM
UBA_e1_C 890 1012 1.04e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147734
Meta Mutation Damage Score 0.5664 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.9%
  • 20x: 88.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in neurons exhibit decreased weight, postnatal and premature lethality and altered social behavior and neuronal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih2 T C 9: 108,608,679 N345D probably damaging Het
Ascc3 C T 10: 50,637,999 S298L possibly damaging Het
Cacna1e A G 1: 154,442,251 Y1462H probably damaging Het
Car9 T C 4: 43,509,212 probably null Het
Cenpc1 A T 5: 86,037,371 M427K probably benign Het
Chl1 T A 6: 103,647,301 C57S probably damaging Het
Cntn3 T C 6: 102,420,381 Y77C probably damaging Het
Cobll1 T C 2: 65,089,521 K1187E possibly damaging Het
Fkbpl C T 17: 34,646,052 H265Y possibly damaging Het
Fmo1 T G 1: 162,859,462 E32A probably damaging Het
Fnip2 G A 3: 79,481,189 T715I probably damaging Het
Fzd6 T A 15: 39,025,733 I82K possibly damaging Het
Gm12169 G A 11: 46,528,537 C60Y probably damaging Het
Grm5 T C 7: 87,602,955 S138P probably damaging Het
Klra5 T C 6: 129,903,590 Y115C probably damaging Het
Lgr4 T C 2: 109,991,093 probably benign Het
Limd1 T G 9: 123,516,827 I557S probably benign Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Neb A T 2: 52,243,331 D3398E probably benign Het
Nup155 T C 15: 8,147,252 S1005P probably benign Het
Olfr1396 A T 11: 49,113,692 D11E possibly damaging Het
Olfr69 T C 7: 103,768,181 D72G probably damaging Het
Pebp4 G T 14: 70,059,654 S214I possibly damaging Het
Pex26 T C 6: 121,184,484 probably null Het
Rbbp8 A T 18: 11,715,818 Q230L probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo2 G A 16: 73,956,637 T784M probably damaging Het
Slc5a1 T C 5: 33,146,651 I270T probably benign Het
Spag4 C T 2: 156,067,309 probably benign Het
Stt3a T C 9: 36,749,545 probably benign Het
Svep1 C T 4: 58,096,331 E1430K possibly damaging Het
Ube2j1 T A 4: 33,043,991 probably benign Het
Ubr5 A G 15: 37,997,187 S1741P probably damaging Het
Vmn2r1 A G 3: 64,086,559 T109A probably damaging Het
Vmn2r60 T C 7: 42,135,561 probably benign Het
Vstm2a A G 11: 16,368,388 probably benign Het
Zdhhc20 T A 14: 57,856,619 K195N probably damaging Het
Zfp683 A G 4: 134,058,741 Y393C probably benign Het
Zzz3 T C 3: 152,427,448 S48P probably benign Het
Other mutations in Uba6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Uba6 APN 5 86119407 missense possibly damaging 0.51
IGL01294:Uba6 APN 5 86150048 missense possibly damaging 0.67
IGL01625:Uba6 APN 5 86120529 nonsense probably null
IGL01807:Uba6 APN 5 86122411 missense probably damaging 1.00
IGL01919:Uba6 APN 5 86119386 missense probably benign 0.01
IGL02131:Uba6 APN 5 86150077 missense probably benign 0.18
IGL03107:Uba6 APN 5 86127774 splice site probably benign
R0350:Uba6 UTSW 5 86144378 missense possibly damaging 0.48
R0511:Uba6 UTSW 5 86112750 missense probably damaging 1.00
R0964:Uba6 UTSW 5 86119401 missense possibly damaging 0.47
R1086:Uba6 UTSW 5 86127719 missense probably benign 0.00
R1440:Uba6 UTSW 5 86140423 missense probably damaging 1.00
R1564:Uba6 UTSW 5 86154407 missense probably benign
R2377:Uba6 UTSW 5 86124370 missense possibly damaging 0.90
R2420:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2421:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2422:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2924:Uba6 UTSW 5 86159271 missense probably damaging 1.00
R3723:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R3724:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R4429:Uba6 UTSW 5 86120547 missense probably damaging 0.99
R4590:Uba6 UTSW 5 86112744 missense probably damaging 1.00
R4831:Uba6 UTSW 5 86131338 missense probably benign
R4908:Uba6 UTSW 5 86140434 splice site silent
R5193:Uba6 UTSW 5 86124422 missense probably benign 0.12
R5505:Uba6 UTSW 5 86120546 missense probably benign 0.09
R5560:Uba6 UTSW 5 86131260 missense probably damaging 1.00
R5586:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R5589:Uba6 UTSW 5 86122429 missense probably damaging 0.99
R5787:Uba6 UTSW 5 86112652 makesense probably null
R6255:Uba6 UTSW 5 86164765 missense probably benign 0.25
R6512:Uba6 UTSW 5 86124403 missense probably benign
R6772:Uba6 UTSW 5 86147073 critical splice donor site probably null
R7536:Uba6 UTSW 5 86124332 missense probably benign 0.05
R7571:Uba6 UTSW 5 86147111 missense probably benign 0.02
R7609:Uba6 UTSW 5 86147075 missense probably benign 0.17
R7768:Uba6 UTSW 5 86152920 missense probably benign 0.01
R7866:Uba6 UTSW 5 86172701 missense probably damaging 0.99
R7894:Uba6 UTSW 5 86118065 nonsense probably null
R7922:Uba6 UTSW 5 86122412 synonymous probably null
R7949:Uba6 UTSW 5 86172701 missense probably damaging 0.99
R7977:Uba6 UTSW 5 86118065 nonsense probably null
R8063:Uba6 UTSW 5 86152685 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGAATGGGGAAACTGCATGTGTTGA -3'
(R):5'- TGCAGCCTCCAATACTGGGGAT -3'

Sequencing Primer
(F):5'- AAACTGCATGTGTTGAGATTAGG -3'
(R):5'- tgagaaaagtgaaaccacagataac -3'
Posted On2013-04-16