Incidental Mutation 'R2871:Tnni3k'
ID 253691
Institutional Source Beutler Lab
Gene Symbol Tnni3k
Ensembl Gene ENSMUSG00000040086
Gene Name TNNI3 interacting kinase
Synonyms Cark, D830019J24Rik
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.279) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 154491928-154761044 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 154644387 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064076] [ENSMUST00000143410]
AlphaFold Q5GIG6
Predicted Effect probably null
Transcript: ENSMUST00000064076
SMART Domains Protein: ENSMUSP00000070561
Gene: ENSMUSG00000040086

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 718 6.7e-48 PFAM
Pfam:Pkinase_Tyr 462 718 2.1e-59 PFAM
low complexity region 727 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143410
SMART Domains Protein: ENSMUSP00000122478
Gene: ENSMUSG00000040086

DomainStartEndE-ValueType
coiled coil region 21 49 N/A INTRINSIC
ANK 66 96 9.46e1 SMART
ANK 100 129 4.43e-2 SMART
ANK 133 162 3.15e-7 SMART
ANK 166 195 6.12e-5 SMART
ANK 199 229 1.65e-1 SMART
ANK 233 264 6.07e0 SMART
ANK 268 299 8.99e-3 SMART
ANK 303 334 1.19e-2 SMART
ANK 338 367 7.76e-7 SMART
ANK 380 409 2.43e1 SMART
Pfam:Pkinase 462 674 3.5e-48 PFAM
Pfam:Pkinase_Tyr 462 674 3.6e-52 PFAM
Meta Mutation Damage Score 0.9715 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the MAP kinase kinase kinase (MAPKKK) family of protein kinases. The protein contains ankyrin repeat, protein kinase and serine-rich domains and is thought to play a role in cardiac physiology. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac myocytes exhibit decreased response to cardiac ischemic/reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Tnni3k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Tnni3k APN 3 154,760,192 (GRCm39) missense probably benign 0.00
IGL00852:Tnni3k APN 3 154,760,206 (GRCm39) missense probably benign 0.00
IGL01090:Tnni3k APN 3 154,645,320 (GRCm39) missense possibly damaging 0.69
IGL01593:Tnni3k APN 3 154,646,666 (GRCm39) splice site probably null
IGL01724:Tnni3k APN 3 154,645,263 (GRCm39) missense possibly damaging 0.53
IGL01887:Tnni3k APN 3 154,580,824 (GRCm39) splice site probably null
IGL01992:Tnni3k APN 3 154,667,663 (GRCm39) missense probably damaging 0.99
IGL02945:Tnni3k APN 3 154,743,075 (GRCm39) missense possibly damaging 0.48
IGL02990:Tnni3k APN 3 154,663,395 (GRCm39) missense probably benign 0.01
IGL03069:Tnni3k APN 3 154,647,242 (GRCm39) splice site probably null
IGL03325:Tnni3k APN 3 154,667,451 (GRCm39) missense probably damaging 1.00
IGL03405:Tnni3k APN 3 154,498,404 (GRCm39) splice site probably benign
R0211:Tnni3k UTSW 3 154,760,981 (GRCm39) start gained probably benign
R0682:Tnni3k UTSW 3 154,645,665 (GRCm39) missense probably damaging 1.00
R0693:Tnni3k UTSW 3 154,667,609 (GRCm39) missense probably damaging 1.00
R0907:Tnni3k UTSW 3 154,647,316 (GRCm39) missense probably damaging 1.00
R1109:Tnni3k UTSW 3 154,498,414 (GRCm39) missense possibly damaging 0.83
R1180:Tnni3k UTSW 3 154,581,150 (GRCm39) missense probably damaging 1.00
R1181:Tnni3k UTSW 3 154,581,150 (GRCm39) missense probably damaging 1.00
R1476:Tnni3k UTSW 3 154,735,942 (GRCm39) missense probably benign 0.05
R1496:Tnni3k UTSW 3 154,645,295 (GRCm39) missense probably damaging 1.00
R1687:Tnni3k UTSW 3 154,645,263 (GRCm39) missense possibly damaging 0.53
R1704:Tnni3k UTSW 3 154,533,145 (GRCm39) missense probably benign 0.27
R1913:Tnni3k UTSW 3 154,684,836 (GRCm39) missense probably benign 0.00
R2343:Tnni3k UTSW 3 154,644,466 (GRCm39) missense probably benign 0.00
R2374:Tnni3k UTSW 3 154,492,422 (GRCm39) missense probably benign 0.12
R2869:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R2869:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R2871:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R2872:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R2872:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R2873:Tnni3k UTSW 3 154,644,387 (GRCm39) critical splice donor site probably null
R4858:Tnni3k UTSW 3 154,492,445 (GRCm39) splice site probably null
R5597:Tnni3k UTSW 3 154,577,765 (GRCm39) missense probably damaging 1.00
R5806:Tnni3k UTSW 3 154,533,248 (GRCm39) missense possibly damaging 0.88
R5871:Tnni3k UTSW 3 154,736,007 (GRCm39) missense probably benign 0.23
R6467:Tnni3k UTSW 3 154,674,922 (GRCm39) missense probably damaging 0.97
R6475:Tnni3k UTSW 3 154,646,695 (GRCm39) nonsense probably null
R6882:Tnni3k UTSW 3 154,663,357 (GRCm39) missense possibly damaging 0.49
R6976:Tnni3k UTSW 3 154,498,413 (GRCm39) missense probably benign 0.14
R6986:Tnni3k UTSW 3 154,667,501 (GRCm39) missense probably damaging 1.00
R7207:Tnni3k UTSW 3 154,580,782 (GRCm39) missense probably damaging 1.00
R7539:Tnni3k UTSW 3 154,667,668 (GRCm39) missense probably benign 0.01
R7843:Tnni3k UTSW 3 154,744,161 (GRCm39) missense probably damaging 0.98
R8546:Tnni3k UTSW 3 154,498,444 (GRCm39) missense probably benign
R8787:Tnni3k UTSW 3 154,645,691 (GRCm39) missense probably damaging 0.99
R9011:Tnni3k UTSW 3 154,562,186 (GRCm39) missense probably damaging 1.00
R9031:Tnni3k UTSW 3 154,744,146 (GRCm39) missense probably damaging 1.00
R9098:Tnni3k UTSW 3 154,647,314 (GRCm39) missense possibly damaging 0.67
R9616:Tnni3k UTSW 3 154,667,724 (GRCm39) nonsense probably null
R9655:Tnni3k UTSW 3 154,645,410 (GRCm39) nonsense probably null
R9733:Tnni3k UTSW 3 154,562,244 (GRCm39) missense probably damaging 1.00
Z1088:Tnni3k UTSW 3 154,645,307 (GRCm39) missense probably damaging 1.00
Z1176:Tnni3k UTSW 3 154,744,194 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCTGAGAGGCAGTTACAC -3'
(R):5'- TCCAGACTGAACATTTAACTCCATC -3'

Sequencing Primer
(F):5'- GAGAGGCAGTTACACAGCTTTGTATC -3'
(R):5'- AAAACATCACGGGGTGTTTTC -3'
Posted On 2014-12-04