Mutagenetix > Incidental Mutation

Incidental Mutation 'R2871:Tnni3k'

253691

Institutional Source

Beutler Lab

Gene Symbol

Tnni3k

Ensembl Gene

ENSMUSG00000040086

Gene Name

TNNI3 interacting kinase

Synonyms

Cark, D830019J24Rik

MMRRC Submission

040459-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.296) question?

Stock #

R2871 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

154786291-155055407 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 154938750 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000070561 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064076] [ENSMUST00000143410]

AlphaFold

Q5GIG6

Predicted Effect

probably null
Transcript: ENSMUST00000064076

SMART Domains

Protein: ENSMUSP00000070561
Gene: ENSMUSG00000040086

Domain	Start	End	E-Value	Type
coiled coil region	21	49	N/A	INTRINSIC
ANK	66	96	9.46e1	SMART
ANK	100	129	4.43e-2	SMART
ANK	133	162	3.15e-7	SMART
ANK	166	195	6.12e-5	SMART
ANK	199	229	1.65e-1	SMART
ANK	233	264	6.07e0	SMART
ANK	268	299	8.99e-3	SMART
ANK	303	334	1.19e-2	SMART
ANK	338	367	7.76e-7	SMART
ANK	380	409	2.43e1	SMART
Pfam:Pkinase	462	718	6.7e-48	PFAM
Pfam:Pkinase_Tyr	462	718	2.1e-59	PFAM
low complexity region	727	750	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143410

SMART Domains

Protein: ENSMUSP00000122478
Gene: ENSMUSG00000040086

Domain	Start	End	E-Value	Type
coiled coil region	21	49	N/A	INTRINSIC
ANK	66	96	9.46e1	SMART
ANK	100	129	4.43e-2	SMART
ANK	133	162	3.15e-7	SMART
ANK	166	195	6.12e-5	SMART
ANK	199	229	1.65e-1	SMART
ANK	233	264	6.07e0	SMART
ANK	268	299	8.99e-3	SMART
ANK	303	334	1.19e-2	SMART
ANK	338	367	7.76e-7	SMART
ANK	380	409	2.43e1	SMART
Pfam:Pkinase	462	674	3.5e-48	PFAM
Pfam:Pkinase_Tyr	462	674	3.6e-52	PFAM

Meta Mutation Damage Score

0.9715

Coding Region Coverage

1x: 99.5%
3x: 98.2%
10x: 92.4%
20x: 72.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the MAP kinase kinase kinase (MAPKKK) family of protein kinases. The protein contains ankyrin repeat, protein kinase and serine-rich domains and is thought to play a role in cardiac physiology. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in cardiac myocytes exhibit decreased response to cardiac ischemic/reperfusion injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,955,176	C811R	possibly damaging	Het
AI481877	A	C	4: 59,093,850	L226R	probably damaging	Het
Akap8l	G	A	17: 32,338,442	T65I	possibly damaging	Het
Arid4a	T	A	12: 71,022,260		probably null	Het
Armc2	C	T	10: 41,966,700		probably null	Het
Atp6v1g1	A	G	4: 63,550,021	Y87C	probably benign	Het
Cfap54	A	T	10: 92,921,419	F273I	possibly damaging	Het
Clasrp	C	A	7: 19,585,240		probably benign	Het
Csmd2	T	C	4: 128,557,718	F113S	unknown	Het
Cyp4a14	C	A	4: 115,487,301	G456W	probably damaging	Het
Cyp4a30b	A	G	4: 115,458,362	H260R	possibly damaging	Het
Ddrgk1	T	A	2: 130,664,644		probably benign	Het
Dhx57	A	T	17: 80,251,376	D1051E	probably benign	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Eif4enif1	C	T	11: 3,242,586	P805S	probably damaging	Het
Eml5	C	T	12: 98,865,401	D433N	probably damaging	Het
Fan1	A	G	7: 64,363,190	I668T	probably benign	Het
Frmpd4	A	T	X: 167,477,247	D1166E	probably benign	Het
Gm813	A	T	16: 58,613,979	I125K	probably benign	Het
Gria2	G	A	3: 80,702,492	T670I	probably damaging	Het
Grid2ip	C	A	5: 143,357,929	Q127K	probably benign	Het
Hdhd2	T	C	18: 76,955,006	F44L	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hmcn1	A	T	1: 150,738,716	V1313D	possibly damaging	Het
Ift172	C	T	5: 31,257,861	V1335I	probably benign	Het
Ighv2-2	G	A	12: 113,588,498	T40I	possibly damaging	Het
Kcnk10	T	A	12: 98,434,813	R520S	probably benign	Het
Kif1c	A	G	11: 70,724,081	E567G	probably damaging	Het
Klf8	A	T	X: 153,382,682	E82D	probably damaging	Het
Kpna7	T	C	5: 144,993,935	T367A	probably benign	Het
Lpo	A	G	11: 87,816,524	I221T	possibly damaging	Het
Lrrn3	T	C	12: 41,452,723	I532V	probably benign	Het
Matr3	T	A	18: 35,572,296	S91R	probably benign	Het
Mki67	G	A	7: 135,708,149	P191L	probably benign	Het
Mlxip	A	G	5: 123,452,667	M878V	probably benign	Het
Mpp7	G	A	18: 7,461,678	P65L	possibly damaging	Het
Mroh2a	C	A	1: 88,255,565	L1292I	probably damaging	Het
Msh2	C	A	17: 87,685,584	Q314K	possibly damaging	Het
Mtor	T	A	4: 148,540,030	M2089K	probably benign	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Nlrp4b	C	T	7: 10,710,243	Q40*	probably null	Het
Nomo1	C	A	7: 46,046,937	T293N	probably damaging	Het
Notum	A	G	11: 120,660,196	V48A	probably benign	Het
Npas3	C	T	12: 54,068,013	R542*	probably null	Het
Olfr1101	A	T	2: 86,988,848	C109*	probably null	Het
Olfr419	T	C	1: 174,250,526	S134G	probably benign	Het
Olfr45	A	G	7: 140,691,285	I127V	possibly damaging	Het
Olfr71	C	A	4: 43,706,458	V37L	probably benign	Het
Ostc	T	C	3: 130,703,508	N80S	probably damaging	Het
Palmd	T	C	3: 116,923,751	R366G	possibly damaging	Het
Parp1	A	G	1: 180,573,665	D45G	probably damaging	Het
Pcdhga9	T	A	18: 37,737,471	Y118N	possibly damaging	Het
Pes1	C	A	11: 3,976,834	T372K	probably benign	Het
Pkp4	C	A	2: 59,308,156	T250K	probably benign	Het
Plekhg5	T	A	4: 152,107,503	C433S	probably benign	Het
Plin2	A	G	4: 86,668,678	M1T	probably null	Het
Prdx4	A	G	X: 155,340,464	V15A	probably benign	Het
Psmb8	T	C	17: 34,200,170	I146T	probably damaging	Het
Psmd13	A	T	7: 140,887,055	T116S	probably damaging	Het
Rel	T	C	11: 23,761,129	I13V	probably benign	Het
Reln	C	T	5: 22,049,791	V527I	possibly damaging	Het
Rnf6	T	C	5: 146,210,405	Y601C	probably benign	Het
Rps6kc1	T	C	1: 190,899,569	I48M	probably damaging	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,177,419		probably benign	Het
Slc39a8	T	A	3: 135,886,793		probably null	Het
Sppl2c	C	T	11: 104,187,315	P314S	probably benign	Het
St5	A	T	7: 109,557,430	Y38N	probably benign	Het
Ugt1a1	AT	A	1: 88,212,371		probably null	Het
Vmn2r68	A	C	7: 85,233,626	M306R	probably benign	Het
Vmn2r70	T	A	7: 85,559,019	Y750F	probably damaging	Het
Vwa7	G	A	17: 35,021,242	M395I	probably damaging	Het
Zfp53	A	T	17: 21,508,078	E124D	probably benign	Het

Other mutations in Tnni3k

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Tnni3k	APN	3	155054555	missense	probably benign	0.00
IGL00852:Tnni3k	APN	3	155054569	missense	probably benign	0.00
IGL01090:Tnni3k	APN	3	154939683	missense	possibly damaging	0.69
IGL01593:Tnni3k	APN	3	154941029	splice site	probably null
IGL01724:Tnni3k	APN	3	154939626	missense	possibly damaging	0.53
IGL01887:Tnni3k	APN	3	154875187	splice site	probably null
IGL01992:Tnni3k	APN	3	154962026	missense	probably damaging	0.99
IGL02945:Tnni3k	APN	3	155037438	missense	possibly damaging	0.48
IGL02990:Tnni3k	APN	3	154957758	missense	probably benign	0.01
IGL03069:Tnni3k	APN	3	154941605	splice site	probably null
IGL03325:Tnni3k	APN	3	154961814	missense	probably damaging	1.00
IGL03405:Tnni3k	APN	3	154792767	splice site	probably benign
R0211:Tnni3k	UTSW	3	155055344	start gained	probably benign
R0682:Tnni3k	UTSW	3	154940028	missense	probably damaging	1.00
R0693:Tnni3k	UTSW	3	154961972	missense	probably damaging	1.00
R0907:Tnni3k	UTSW	3	154941679	missense	probably damaging	1.00
R1109:Tnni3k	UTSW	3	154792777	missense	possibly damaging	0.83
R1180:Tnni3k	UTSW	3	154875513	missense	probably damaging	1.00
R1181:Tnni3k	UTSW	3	154875513	missense	probably damaging	1.00
R1476:Tnni3k	UTSW	3	155030305	missense	probably benign	0.05
R1496:Tnni3k	UTSW	3	154939658	missense	probably damaging	1.00
R1687:Tnni3k	UTSW	3	154939626	missense	possibly damaging	0.53
R1704:Tnni3k	UTSW	3	154827508	missense	probably benign	0.27
R1913:Tnni3k	UTSW	3	154979199	missense	probably benign	0.00
R2343:Tnni3k	UTSW	3	154938829	missense	probably benign	0.00
R2374:Tnni3k	UTSW	3	154786785	missense	probably benign	0.12
R2869:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R2869:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R2871:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R2872:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R2872:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R2873:Tnni3k	UTSW	3	154938750	critical splice donor site	probably null
R4858:Tnni3k	UTSW	3	154786808	splice site	probably null
R5597:Tnni3k	UTSW	3	154872128	missense	probably damaging	1.00
R5806:Tnni3k	UTSW	3	154827611	missense	possibly damaging	0.88
R5871:Tnni3k	UTSW	3	155030370	missense	probably benign	0.23
R6467:Tnni3k	UTSW	3	154969285	missense	probably damaging	0.97
R6475:Tnni3k	UTSW	3	154941058	nonsense	probably null
R6882:Tnni3k	UTSW	3	154957720	missense	possibly damaging	0.49
R6976:Tnni3k	UTSW	3	154792776	missense	probably benign	0.14
R6986:Tnni3k	UTSW	3	154961864	missense	probably damaging	1.00
R7207:Tnni3k	UTSW	3	154875145	missense	probably damaging	1.00
R7539:Tnni3k	UTSW	3	154962031	missense	probably benign	0.01
R7843:Tnni3k	UTSW	3	155038524	missense	probably damaging	0.98
R8546:Tnni3k	UTSW	3	154792807	missense	probably benign
R8787:Tnni3k	UTSW	3	154940054	missense	probably damaging	0.99
R9011:Tnni3k	UTSW	3	154856549	missense	probably damaging	1.00
R9031:Tnni3k	UTSW	3	155038509	missense	probably damaging	1.00
R9098:Tnni3k	UTSW	3	154941677	missense	possibly damaging	0.67
R9616:Tnni3k	UTSW	3	154962087	nonsense	probably null
R9655:Tnni3k	UTSW	3	154939773	nonsense	probably null
R9733:Tnni3k	UTSW	3	154856607	missense	probably damaging	1.00
Z1088:Tnni3k	UTSW	3	154939670	missense	probably damaging	1.00
Z1176:Tnni3k	UTSW	3	155038557	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCCTGAGAGGCAGTTACAC -3'
(R):5'- TCCAGACTGAACATTTAACTCCATC -3'

Sequencing Primer
(F):5'- GAGAGGCAGTTACACAGCTTTGTATC -3'
(R):5'- AAAACATCACGGGGTGTTTTC -3'

Posted On

2014-12-04