Incidental Mutation 'R2871:Plekhg5'
ID 253707
Institutional Source Beutler Lab
Gene Symbol Plekhg5
Ensembl Gene ENSMUSG00000039713
Gene Name pleckstrin homology domain containing, family G (with RhoGef domain) member 5
Synonyms
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.152) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 152156955-152199857 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 152191960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 433 (C433S)
Ref Sequence ENSEMBL: ENSMUSP00000112707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084115] [ENSMUST00000105661] [ENSMUST00000105662] [ENSMUST00000118648]
AlphaFold Q66T02
Predicted Effect probably benign
Transcript: ENSMUST00000084115
AA Change: C446S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081132
Gene: ENSMUSG00000039713
AA Change: C446S

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105661
AA Change: C446S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101286
Gene: ENSMUSG00000039713
AA Change: C446S

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105662
AA Change: C414S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101287
Gene: ENSMUSG00000039713
AA Change: C414S

DomainStartEndE-ValueType
low complexity region 282 302 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
RhoGEF 378 565 5.21e-53 SMART
PH 623 724 7.35e-12 SMART
low complexity region 746 758 N/A INTRINSIC
low complexity region 863 902 N/A INTRINSIC
low complexity region 1028 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118648
AA Change: C433S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112707
Gene: ENSMUSG00000039713
AA Change: C433S

DomainStartEndE-ValueType
low complexity region 301 321 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
RhoGEF 397 584 5.21e-53 SMART
PH 642 743 7.35e-12 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 882 921 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142412
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the Rho guanine exchange factor (GEF) family of proteins, which activate GTPases by replacing GDP with GTP. This family member is a RhoA GEF that plays a role in endothelial cell migration and tube formation. It is required for angiogenesis and may function in neuronal cell differentiation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display angiogenic defects that affect multiple organs, including sparser coronary and kidney arterial systems that appear to deficient in small diameter vessels while the major coronary and kidney arteries remain intact. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ift172 C T 5: 31,415,205 (GRCm39) V1335I probably benign Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Plekhg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Plekhg5 APN 4 152,186,498 (GRCm39) splice site probably null
IGL01025:Plekhg5 APN 4 152,192,983 (GRCm39) missense probably damaging 1.00
IGL01062:Plekhg5 APN 4 152,192,953 (GRCm39) missense probably damaging 1.00
IGL01138:Plekhg5 APN 4 152,191,435 (GRCm39) missense probably damaging 1.00
IGL01301:Plekhg5 APN 4 152,197,010 (GRCm39) missense probably benign
IGL02372:Plekhg5 APN 4 152,186,537 (GRCm39) missense probably damaging 0.96
IGL02701:Plekhg5 APN 4 152,187,479 (GRCm39) missense probably damaging 1.00
ANU18:Plekhg5 UTSW 4 152,197,010 (GRCm39) missense probably benign
R0005:Plekhg5 UTSW 4 152,197,108 (GRCm39) small deletion probably benign
R0012:Plekhg5 UTSW 4 152,189,207 (GRCm39) missense probably benign 0.20
R0050:Plekhg5 UTSW 4 152,192,545 (GRCm39) critical splice donor site probably null
R0233:Plekhg5 UTSW 4 152,196,676 (GRCm39) missense probably damaging 1.00
R0233:Plekhg5 UTSW 4 152,196,676 (GRCm39) missense probably damaging 1.00
R0234:Plekhg5 UTSW 4 152,196,676 (GRCm39) missense probably damaging 1.00
R0346:Plekhg5 UTSW 4 152,198,710 (GRCm39) missense probably benign 0.08
R0555:Plekhg5 UTSW 4 152,191,926 (GRCm39) nonsense probably null
R0631:Plekhg5 UTSW 4 152,196,876 (GRCm39) missense possibly damaging 0.89
R0639:Plekhg5 UTSW 4 152,198,577 (GRCm39) missense probably benign 0.19
R1372:Plekhg5 UTSW 4 152,189,188 (GRCm39) missense probably damaging 0.99
R1563:Plekhg5 UTSW 4 152,181,266 (GRCm39) missense probably benign 0.33
R2870:Plekhg5 UTSW 4 152,191,960 (GRCm39) missense probably benign 0.01
R2870:Plekhg5 UTSW 4 152,191,960 (GRCm39) missense probably benign 0.01
R2871:Plekhg5 UTSW 4 152,191,960 (GRCm39) missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152,191,960 (GRCm39) missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152,191,960 (GRCm39) missense probably benign 0.01
R2873:Plekhg5 UTSW 4 152,191,960 (GRCm39) missense probably benign 0.01
R3104:Plekhg5 UTSW 4 152,196,635 (GRCm39) missense probably damaging 1.00
R3106:Plekhg5 UTSW 4 152,196,635 (GRCm39) missense probably damaging 1.00
R3408:Plekhg5 UTSW 4 152,192,749 (GRCm39) missense probably damaging 1.00
R4289:Plekhg5 UTSW 4 152,196,884 (GRCm39) missense probably benign 0.05
R5157:Plekhg5 UTSW 4 152,192,322 (GRCm39) splice site probably benign
R5643:Plekhg5 UTSW 4 152,188,797 (GRCm39) missense probably benign 0.14
R5644:Plekhg5 UTSW 4 152,188,797 (GRCm39) missense probably benign 0.14
R5790:Plekhg5 UTSW 4 152,198,392 (GRCm39) missense probably benign
R6770:Plekhg5 UTSW 4 152,187,536 (GRCm39) missense probably benign
R7027:Plekhg5 UTSW 4 152,198,431 (GRCm39) missense probably benign 0.01
R7039:Plekhg5 UTSW 4 152,192,242 (GRCm39) missense possibly damaging 0.90
R7092:Plekhg5 UTSW 4 152,198,965 (GRCm39) missense probably damaging 1.00
R7309:Plekhg5 UTSW 4 152,196,985 (GRCm39) missense possibly damaging 0.50
R7319:Plekhg5 UTSW 4 152,192,885 (GRCm39) missense probably benign 0.13
R7439:Plekhg5 UTSW 4 152,198,392 (GRCm39) missense probably benign 0.19
R7543:Plekhg5 UTSW 4 152,192,491 (GRCm39) missense probably damaging 1.00
R7662:Plekhg5 UTSW 4 152,188,755 (GRCm39) missense probably damaging 1.00
R8271:Plekhg5 UTSW 4 152,187,464 (GRCm39) missense probably damaging 1.00
R8322:Plekhg5 UTSW 4 152,189,201 (GRCm39) missense possibly damaging 0.77
R8827:Plekhg5 UTSW 4 152,191,462 (GRCm39) splice site probably benign
R8987:Plekhg5 UTSW 4 152,188,372 (GRCm39) intron probably benign
R9024:Plekhg5 UTSW 4 152,197,118 (GRCm39) missense possibly damaging 0.71
R9428:Plekhg5 UTSW 4 152,192,780 (GRCm39) missense probably benign 0.00
R9515:Plekhg5 UTSW 4 152,198,826 (GRCm39) missense probably benign 0.09
R9672:Plekhg5 UTSW 4 152,187,541 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAACGCCCTCTTTATTTTGGG -3'
(R):5'- TGGCGATCTCAGGAATGTTGC -3'

Sequencing Primer
(F):5'- CCCTCTTTATTTTGGGGTGCTTATG -3'
(R):5'- CAACCTGGGCGTACACAAGTG -3'
Posted On 2014-12-04