Incidental Mutation 'R2871:Ift172'
ID 253712
Institutional Source Beutler Lab
Gene Symbol Ift172
Ensembl Gene ENSMUSG00000038564
Gene Name intraflagellar transport 172
Synonyms 4930553F24Rik, wim, avc1
MMRRC Submission 040459-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2871 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 31410623-31448458 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 31415205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1335 (V1335I)
Ref Sequence ENSEMBL: ENSMUSP00000049335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041565] [ENSMUST00000054829] [ENSMUST00000201625] [ENSMUST00000201937]
AlphaFold Q6VH22
Predicted Effect probably benign
Transcript: ENSMUST00000041565
AA Change: V1335I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564
AA Change: V1335I

DomainStartEndE-ValueType
WD40 2 44 6e-3 SMART
WD40 55 94 2.22e0 SMART
WD40 102 139 1.23e2 SMART
WD40 141 180 4.6e0 SMART
WD40 186 223 3.3e1 SMART
WD40 225 267 4.42e1 SMART
WD40 279 314 1.03e1 SMART
Blast:WD40 516 550 5e-13 BLAST
low complexity region 573 588 N/A INTRINSIC
internal_repeat_1 625 1026 1.7e-10 PROSPERO
Blast:TPR 1029 1062 2e-13 BLAST
low complexity region 1077 1091 N/A INTRINSIC
internal_repeat_1 1101 1498 1.7e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000054829
SMART Domains Protein: ENSMUSP00000060414
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 211 8.6e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202560
Predicted Effect probably benign
Transcript: ENSMUST00000201625
SMART Domains Protein: ENSMUSP00000144052
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 206 1.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201937
SMART Domains Protein: ENSMUSP00000144464
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 206 1.8e-74 PFAM
Meta Mutation Damage Score 0.1009 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the intraflagellar transport subcomplex IFT-B. Subcomplexes IFT-A and IFT-B are necessary for ciliary assembly and maintenance. Mutations in this gene have been associated with skeletal ciliopathies, with or without polydactyly, such as such short-rib thoracic dysplasias 1, 9 or 10. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis, neural tube defects, and developmental patterning abnormalities. Mice homozygous for a conditional allele activated in the early limb bud exhibit polydactyly and short limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,846,002 (GRCm39) C811R possibly damaging Het
Akap8l G A 17: 32,557,416 (GRCm39) T65I possibly damaging Het
Arid4a T A 12: 71,069,034 (GRCm39) probably null Het
Armc2 C T 10: 41,842,696 (GRCm39) probably null Het
Atp6v1g1 A G 4: 63,468,258 (GRCm39) Y87C probably benign Het
Cfap54 A T 10: 92,757,281 (GRCm39) F273I possibly damaging Het
Clasrp C A 7: 19,319,165 (GRCm39) probably benign Het
Csmd2 T C 4: 128,451,511 (GRCm39) F113S unknown Het
Cyp4a14 C A 4: 115,344,498 (GRCm39) G456W probably damaging Het
Cyp4a30b A G 4: 115,315,559 (GRCm39) H260R possibly damaging Het
Ddrgk1 T A 2: 130,506,564 (GRCm39) probably benign Het
Dennd2b A T 7: 109,156,637 (GRCm39) Y38N probably benign Het
Dhx57 A T 17: 80,558,805 (GRCm39) D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,014,601 (GRCm39) probably null Het
Eif4enif1 C T 11: 3,192,586 (GRCm39) P805S probably damaging Het
Eml5 C T 12: 98,831,660 (GRCm39) D433N probably damaging Het
Fan1 A G 7: 64,012,938 (GRCm39) I668T probably benign Het
Frmpd4 A T X: 166,260,243 (GRCm39) D1166E probably benign Het
Ftdc1 A T 16: 58,434,342 (GRCm39) I125K probably benign Het
Gria2 G A 3: 80,609,799 (GRCm39) T670I probably damaging Het
Grid2ip C A 5: 143,343,684 (GRCm39) Q127K probably benign Het
Hdhd2 T C 18: 77,042,702 (GRCm39) F44L probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmcn1 A T 1: 150,614,467 (GRCm39) V1313D possibly damaging Het
Ighv2-2 G A 12: 113,552,118 (GRCm39) T40I possibly damaging Het
Kcnk10 T A 12: 98,401,072 (GRCm39) R520S probably benign Het
Kif1c A G 11: 70,614,907 (GRCm39) E567G probably damaging Het
Klf8 A T X: 152,165,678 (GRCm39) E82D probably damaging Het
Kpna7 T C 5: 144,930,745 (GRCm39) T367A probably benign Het
Lpo A G 11: 87,707,350 (GRCm39) I221T possibly damaging Het
Lrrn3 T C 12: 41,502,722 (GRCm39) I532V probably benign Het
Matr3 T A 18: 35,705,349 (GRCm39) S91R probably benign Het
Mki67 G A 7: 135,309,878 (GRCm39) P191L probably benign Het
Mlxip A G 5: 123,590,730 (GRCm39) M878V probably benign Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Msh2 C A 17: 87,993,012 (GRCm39) Q314K possibly damaging Het
Mtor T A 4: 148,624,487 (GRCm39) M2089K probably benign Het
Myo9b G A 8: 71,786,981 (GRCm39) R721Q probably benign Het
Nlrp4b C T 7: 10,444,170 (GRCm39) Q40* probably null Het
Nomo1 C A 7: 45,696,361 (GRCm39) T293N probably damaging Het
Notum A G 11: 120,551,022 (GRCm39) V48A probably benign Het
Npas3 C T 12: 54,114,796 (GRCm39) R542* probably null Het
Or10z1 T C 1: 174,078,092 (GRCm39) S134G probably benign Het
Or13a17 A G 7: 140,271,198 (GRCm39) I127V possibly damaging Het
Or13j1 C A 4: 43,706,458 (GRCm39) V37L probably benign Het
Or5t16 A T 2: 86,819,192 (GRCm39) C109* probably null Het
Ostc T C 3: 130,497,157 (GRCm39) N80S probably damaging Het
Palmd T C 3: 116,717,400 (GRCm39) R366G possibly damaging Het
Parp1 A G 1: 180,401,230 (GRCm39) D45G probably damaging Het
Pcdhga9 T A 18: 37,870,524 (GRCm39) Y118N possibly damaging Het
Pes1 C A 11: 3,926,834 (GRCm39) T372K probably benign Het
Pkp4 C A 2: 59,138,500 (GRCm39) T250K probably benign Het
Plekhg5 T A 4: 152,191,960 (GRCm39) C433S probably benign Het
Plin2 A G 4: 86,586,915 (GRCm39) M1T probably null Het
Prdx4 A G X: 154,123,460 (GRCm39) V15A probably benign Het
Psmb8 T C 17: 34,419,144 (GRCm39) I146T probably damaging Het
Psmd13 A T 7: 140,466,968 (GRCm39) T116S probably damaging Het
Rel T C 11: 23,711,129 (GRCm39) I13V probably benign Het
Reln C T 5: 22,254,789 (GRCm39) V527I possibly damaging Het
Rnf6 T C 5: 146,147,215 (GRCm39) Y601C probably benign Het
Rps6kc1 T C 1: 190,631,766 (GRCm39) I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Shoc1 A C 4: 59,093,850 (GRCm39) L226R probably damaging Het
Slc39a8 T A 3: 135,592,554 (GRCm39) probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tnni3k C T 3: 154,644,387 (GRCm39) probably null Het
Ugt1a1 AT A 1: 88,140,093 (GRCm39) probably null Het
Vmn2r68 A C 7: 84,882,834 (GRCm39) M306R probably benign Het
Vmn2r70 T A 7: 85,208,227 (GRCm39) Y750F probably damaging Het
Vwa7 G A 17: 35,240,218 (GRCm39) M395I probably damaging Het
Zfp53 A T 17: 21,728,340 (GRCm39) E124D probably benign Het
Other mutations in Ift172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ift172 APN 5 31,433,240 (GRCm39) missense probably damaging 1.00
IGL01399:Ift172 APN 5 31,423,592 (GRCm39) missense probably benign
IGL01405:Ift172 APN 5 31,419,196 (GRCm39) nonsense probably null
IGL01562:Ift172 APN 5 31,424,591 (GRCm39) missense probably damaging 0.97
IGL01758:Ift172 APN 5 31,438,058 (GRCm39) missense probably benign
IGL01792:Ift172 APN 5 31,434,215 (GRCm39) missense probably damaging 1.00
IGL01830:Ift172 APN 5 31,442,636 (GRCm39) missense probably damaging 1.00
IGL01839:Ift172 APN 5 31,423,694 (GRCm39) missense probably damaging 1.00
IGL02007:Ift172 APN 5 31,443,948 (GRCm39) missense probably benign 0.17
IGL02172:Ift172 APN 5 31,438,681 (GRCm39) splice site probably benign
IGL02190:Ift172 APN 5 31,411,802 (GRCm39) missense possibly damaging 0.51
IGL02334:Ift172 APN 5 31,440,402 (GRCm39) missense probably benign 0.00
IGL02486:Ift172 APN 5 31,414,927 (GRCm39) missense probably damaging 1.00
IGL02517:Ift172 APN 5 31,410,992 (GRCm39) splice site probably null
IGL02571:Ift172 APN 5 31,415,235 (GRCm39) missense probably damaging 1.00
IGL02626:Ift172 APN 5 31,421,840 (GRCm39) missense probably benign
IGL03183:Ift172 APN 5 31,429,348 (GRCm39) missense probably benign 0.06
IGL03277:Ift172 APN 5 31,424,642 (GRCm39) missense possibly damaging 0.92
IGL03349:Ift172 APN 5 31,441,474 (GRCm39) missense probably benign 0.05
ostinato UTSW 5 31,434,284 (GRCm39) missense probably benign 0.10
pushback UTSW 5 31,444,289 (GRCm39) missense probably damaging 1.00
P0042:Ift172 UTSW 5 31,418,799 (GRCm39) missense probably benign 0.35
PIT4802001:Ift172 UTSW 5 31,442,610 (GRCm39) missense probably benign 0.03
R0153:Ift172 UTSW 5 31,417,968 (GRCm39) missense probably benign
R0328:Ift172 UTSW 5 31,421,195 (GRCm39) nonsense probably null
R0357:Ift172 UTSW 5 31,415,244 (GRCm39) missense possibly damaging 0.51
R0369:Ift172 UTSW 5 31,410,985 (GRCm39) missense probably damaging 1.00
R0391:Ift172 UTSW 5 31,444,011 (GRCm39) missense probably damaging 1.00
R0512:Ift172 UTSW 5 31,442,821 (GRCm39) missense possibly damaging 0.92
R0546:Ift172 UTSW 5 31,414,945 (GRCm39) missense probably benign 0.14
R0553:Ift172 UTSW 5 31,433,186 (GRCm39) splice site probably benign
R0606:Ift172 UTSW 5 31,411,657 (GRCm39) missense probably damaging 0.99
R0834:Ift172 UTSW 5 31,414,715 (GRCm39) missense probably benign
R0973:Ift172 UTSW 5 31,415,262 (GRCm39) unclassified probably benign
R0973:Ift172 UTSW 5 31,422,699 (GRCm39) missense probably benign
R1189:Ift172 UTSW 5 31,443,174 (GRCm39) critical splice acceptor site probably null
R1205:Ift172 UTSW 5 31,443,136 (GRCm39) missense probably benign
R1289:Ift172 UTSW 5 31,438,320 (GRCm39) missense probably damaging 0.98
R1342:Ift172 UTSW 5 31,419,210 (GRCm39) missense probably benign
R1395:Ift172 UTSW 5 31,442,582 (GRCm39) unclassified probably benign
R1417:Ift172 UTSW 5 31,413,993 (GRCm39) missense probably damaging 1.00
R2020:Ift172 UTSW 5 31,424,585 (GRCm39) nonsense probably null
R2111:Ift172 UTSW 5 31,443,423 (GRCm39) missense probably benign 0.04
R2175:Ift172 UTSW 5 31,424,029 (GRCm39) missense probably damaging 1.00
R2509:Ift172 UTSW 5 31,420,312 (GRCm39) missense probably benign
R2870:Ift172 UTSW 5 31,415,205 (GRCm39) missense probably benign 0.00
R2870:Ift172 UTSW 5 31,415,205 (GRCm39) missense probably benign 0.00
R2871:Ift172 UTSW 5 31,415,205 (GRCm39) missense probably benign 0.00
R2872:Ift172 UTSW 5 31,415,205 (GRCm39) missense probably benign 0.00
R2872:Ift172 UTSW 5 31,415,205 (GRCm39) missense probably benign 0.00
R3705:Ift172 UTSW 5 31,418,781 (GRCm39) critical splice donor site probably null
R3793:Ift172 UTSW 5 31,414,925 (GRCm39) missense possibly damaging 0.61
R4385:Ift172 UTSW 5 31,444,311 (GRCm39) missense probably damaging 1.00
R4477:Ift172 UTSW 5 31,422,781 (GRCm39) missense probably benign 0.38
R4590:Ift172 UTSW 5 31,411,299 (GRCm39) missense probably damaging 1.00
R4663:Ift172 UTSW 5 31,441,559 (GRCm39) missense probably benign 0.01
R4665:Ift172 UTSW 5 31,442,598 (GRCm39) missense possibly damaging 0.82
R4977:Ift172 UTSW 5 31,429,460 (GRCm39) missense possibly damaging 0.79
R5109:Ift172 UTSW 5 31,423,330 (GRCm39) missense probably benign 0.06
R5182:Ift172 UTSW 5 31,424,958 (GRCm39) missense possibly damaging 0.51
R5343:Ift172 UTSW 5 31,421,156 (GRCm39) missense probably benign 0.05
R5465:Ift172 UTSW 5 31,418,862 (GRCm39) splice site probably null
R5622:Ift172 UTSW 5 31,440,426 (GRCm39) missense probably damaging 1.00
R5718:Ift172 UTSW 5 31,412,621 (GRCm39) missense possibly damaging 0.94
R5793:Ift172 UTSW 5 31,434,292 (GRCm39) missense possibly damaging 0.96
R5870:Ift172 UTSW 5 31,434,284 (GRCm39) missense probably benign 0.10
R5919:Ift172 UTSW 5 31,418,006 (GRCm39) missense possibly damaging 0.63
R5968:Ift172 UTSW 5 31,418,828 (GRCm39) missense probably damaging 1.00
R6112:Ift172 UTSW 5 31,414,241 (GRCm39) missense probably benign
R6339:Ift172 UTSW 5 31,444,289 (GRCm39) missense probably damaging 1.00
R6339:Ift172 UTSW 5 31,413,927 (GRCm39) missense probably benign 0.00
R6355:Ift172 UTSW 5 31,441,501 (GRCm39) missense probably benign 0.33
R6565:Ift172 UTSW 5 31,433,227 (GRCm39) missense possibly damaging 0.68
R6668:Ift172 UTSW 5 31,412,683 (GRCm39) missense probably benign 0.00
R6755:Ift172 UTSW 5 31,418,342 (GRCm39) nonsense probably null
R6818:Ift172 UTSW 5 31,423,304 (GRCm39) missense probably benign 0.01
R6939:Ift172 UTSW 5 31,414,930 (GRCm39) missense probably damaging 1.00
R6980:Ift172 UTSW 5 31,414,730 (GRCm39) missense probably benign
R7047:Ift172 UTSW 5 31,433,238 (GRCm39) nonsense probably null
R7156:Ift172 UTSW 5 31,429,419 (GRCm39) missense probably damaging 1.00
R7180:Ift172 UTSW 5 31,411,606 (GRCm39) missense probably damaging 1.00
R7288:Ift172 UTSW 5 31,442,630 (GRCm39) missense probably damaging 1.00
R7351:Ift172 UTSW 5 31,433,240 (GRCm39) missense probably damaging 1.00
R7706:Ift172 UTSW 5 31,423,723 (GRCm39) nonsense probably null
R7890:Ift172 UTSW 5 31,440,425 (GRCm39) nonsense probably null
R7980:Ift172 UTSW 5 31,417,988 (GRCm39) missense probably benign
R8263:Ift172 UTSW 5 31,422,681 (GRCm39) missense possibly damaging 0.48
R8559:Ift172 UTSW 5 31,413,921 (GRCm39) missense probably damaging 0.98
R8717:Ift172 UTSW 5 31,412,985 (GRCm39) missense probably benign 0.00
R8774:Ift172 UTSW 5 31,415,207 (GRCm39) missense probably benign 0.45
R8774-TAIL:Ift172 UTSW 5 31,415,207 (GRCm39) missense probably benign 0.45
R9037:Ift172 UTSW 5 31,420,400 (GRCm39) missense possibly damaging 0.56
R9038:Ift172 UTSW 5 31,441,399 (GRCm39) missense possibly damaging 0.53
R9133:Ift172 UTSW 5 31,442,867 (GRCm39) missense probably benign 0.00
R9607:Ift172 UTSW 5 31,410,913 (GRCm39) missense
X0022:Ift172 UTSW 5 31,442,664 (GRCm39) missense probably damaging 0.97
Z1176:Ift172 UTSW 5 31,434,268 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAATGATCTTTCCATGTGACGC -3'
(R):5'- CTGAAGAGCTGTTAGCCAGG -3'

Sequencing Primer
(F):5'- ACGCAGTGGTCTTCCCC -3'
(R):5'- ACGAGCCAGGCTTCCATG -3'
Posted On 2014-12-04