Mutagenetix > Incidental Mutation

Incidental Mutation 'R2871:Ift172'

253712

Institutional Source

Beutler Lab

Gene Symbol

Ift172

Ensembl Gene

ENSMUSG00000038564

Gene Name

intraflagellar transport 172

Synonyms

wim

MMRRC Submission

040459-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2871 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31253277-31291116 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 31257861 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1335 (V1335I)

Ref Sequence

ENSEMBL: ENSMUSP00000049335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041565] [ENSMUST00000054829] [ENSMUST00000201625] [ENSMUST00000201937]

AlphaFold

Q6VH22

Predicted Effect

probably benign
Transcript: ENSMUST00000041565
AA Change: V1335I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564
AA Change: V1335I

Domain	Start	End	E-Value	Type
WD40	2	44	6e-3	SMART
WD40	55	94	2.22e0	SMART
WD40	102	139	1.23e2	SMART
WD40	141	180	4.6e0	SMART
WD40	186	223	3.3e1	SMART
WD40	225	267	4.42e1	SMART
WD40	279	314	1.03e1	SMART
Blast:WD40	516	550	5e-13	BLAST
low complexity region	573	588	N/A	INTRINSIC
internal_repeat_1	625	1026	1.7e-10	PROSPERO
Blast:TPR	1029	1062	2e-13	BLAST
low complexity region	1077	1091	N/A	INTRINSIC
internal_repeat_1	1101	1498	1.7e-10	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000054829

SMART Domains

Protein: ENSMUSP00000060414
Gene: ENSMUSG00000029149

Domain	Start	End	E-Value	Type
Pfam:BCLP	19	211	8.6e-80	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200936

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201333

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201393

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201426

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201565

Predicted Effect

probably benign
Transcript: ENSMUST00000201625

SMART Domains

Protein: ENSMUSP00000144052
Gene: ENSMUSG00000029149

Domain	Start	End	E-Value	Type
Pfam:BCLP	19	206	1.8e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201672

Predicted Effect

probably benign
Transcript: ENSMUST00000201937

SMART Domains

Protein: ENSMUSP00000144464
Gene: ENSMUSG00000029149

Domain	Start	End	E-Value	Type
Pfam:BCLP	19	206	1.8e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201953

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202007

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202384

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202560

Meta Mutation Damage Score

0.1009

Coding Region Coverage

1x: 99.5%
3x: 98.2%
10x: 92.4%
20x: 72.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the intraflagellar transport subcomplex IFT-B. Subcomplexes IFT-A and IFT-B are necessary for ciliary assembly and maintenance. Mutations in this gene have been associated with skeletal ciliopathies, with or without polydactyly, such as such short-rib thoracic dysplasias 1, 9 or 10. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis, neural tube defects, and developmental patterning abnormalities. Mice homozygous for a conditional allele activated in the early limb bud exhibit polydactyly and short limbs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,955,176	C811R	possibly damaging	Het
AI481877	A	C	4: 59,093,850	L226R	probably damaging	Het
Akap8l	G	A	17: 32,338,442	T65I	possibly damaging	Het
Arid4a	T	A	12: 71,022,260		probably null	Het
Armc2	C	T	10: 41,966,700		probably null	Het
Atp6v1g1	A	G	4: 63,550,021	Y87C	probably benign	Het
Cfap54	A	T	10: 92,921,419	F273I	possibly damaging	Het
Clasrp	C	A	7: 19,585,240		probably benign	Het
Csmd2	T	C	4: 128,557,718	F113S	unknown	Het
Cyp4a14	C	A	4: 115,487,301	G456W	probably damaging	Het
Cyp4a30b	A	G	4: 115,458,362	H260R	possibly damaging	Het
Ddrgk1	T	A	2: 130,664,644		probably benign	Het
Dhx57	A	T	17: 80,251,376	D1051E	probably benign	Het
Eef2	GCCC	GCCCC	10: 81,178,767		probably null	Het
Eif4enif1	C	T	11: 3,242,586	P805S	probably damaging	Het
Eml5	C	T	12: 98,865,401	D433N	probably damaging	Het
Fan1	A	G	7: 64,363,190	I668T	probably benign	Het
Frmpd4	A	T	X: 167,477,247	D1166E	probably benign	Het
Gm813	A	T	16: 58,613,979	I125K	probably benign	Het
Gria2	G	A	3: 80,702,492	T670I	probably damaging	Het
Grid2ip	C	A	5: 143,357,929	Q127K	probably benign	Het
Hdhd2	T	C	18: 76,955,006	F44L	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hmcn1	A	T	1: 150,738,716	V1313D	possibly damaging	Het
Ighv2-2	G	A	12: 113,588,498	T40I	possibly damaging	Het
Kcnk10	T	A	12: 98,434,813	R520S	probably benign	Het
Kif1c	A	G	11: 70,724,081	E567G	probably damaging	Het
Klf8	A	T	X: 153,382,682	E82D	probably damaging	Het
Kpna7	T	C	5: 144,993,935	T367A	probably benign	Het
Lpo	A	G	11: 87,816,524	I221T	possibly damaging	Het
Lrrn3	T	C	12: 41,452,723	I532V	probably benign	Het
Matr3	T	A	18: 35,572,296	S91R	probably benign	Het
Mki67	G	A	7: 135,708,149	P191L	probably benign	Het
Mlxip	A	G	5: 123,452,667	M878V	probably benign	Het
Mpp7	G	A	18: 7,461,678	P65L	possibly damaging	Het
Mroh2a	C	A	1: 88,255,565	L1292I	probably damaging	Het
Msh2	C	A	17: 87,685,584	Q314K	possibly damaging	Het
Mtor	T	A	4: 148,540,030	M2089K	probably benign	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Nlrp4b	C	T	7: 10,710,243	Q40*	probably null	Het
Nomo1	C	A	7: 46,046,937	T293N	probably damaging	Het
Notum	A	G	11: 120,660,196	V48A	probably benign	Het
Npas3	C	T	12: 54,068,013	R542*	probably null	Het
Olfr1101	A	T	2: 86,988,848	C109*	probably null	Het
Olfr419	T	C	1: 174,250,526	S134G	probably benign	Het
Olfr45	A	G	7: 140,691,285	I127V	possibly damaging	Het
Olfr71	C	A	4: 43,706,458	V37L	probably benign	Het
Ostc	T	C	3: 130,703,508	N80S	probably damaging	Het
Palmd	T	C	3: 116,923,751	R366G	possibly damaging	Het
Parp1	A	G	1: 180,573,665	D45G	probably damaging	Het
Pcdhga9	T	A	18: 37,737,471	Y118N	possibly damaging	Het
Pes1	C	A	11: 3,976,834	T372K	probably benign	Het
Pkp4	C	A	2: 59,308,156	T250K	probably benign	Het
Plekhg5	T	A	4: 152,107,503	C433S	probably benign	Het
Plin2	A	G	4: 86,668,678	M1T	probably null	Het
Prdx4	A	G	X: 155,340,464	V15A	probably benign	Het
Psmb8	T	C	17: 34,200,170	I146T	probably damaging	Het
Psmd13	A	T	7: 140,887,055	T116S	probably damaging	Het
Rel	T	C	11: 23,761,129	I13V	probably benign	Het
Reln	C	T	5: 22,049,791	V527I	possibly damaging	Het
Rnf6	T	C	5: 146,210,405	Y601C	probably benign	Het
Rps6kc1	T	C	1: 190,899,569	I48M	probably damaging	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,177,419		probably benign	Het
Slc39a8	T	A	3: 135,886,793		probably null	Het
Sppl2c	C	T	11: 104,187,315	P314S	probably benign	Het
St5	A	T	7: 109,557,430	Y38N	probably benign	Het
Tnni3k	C	T	3: 154,938,750		probably null	Het
Ugt1a1	AT	A	1: 88,212,371		probably null	Het
Vmn2r68	A	C	7: 85,233,626	M306R	probably benign	Het
Vmn2r70	T	A	7: 85,559,019	Y750F	probably damaging	Het
Vwa7	G	A	17: 35,021,242	M395I	probably damaging	Het
Zfp53	A	T	17: 21,508,078	E124D	probably benign	Het

Other mutations in Ift172

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00476:Ift172	APN	5	31275896	missense	probably damaging	1.00
IGL01399:Ift172	APN	5	31266248	missense	probably benign
IGL01405:Ift172	APN	5	31261852	nonsense	probably null
IGL01562:Ift172	APN	5	31267247	missense	probably damaging	0.97
IGL01758:Ift172	APN	5	31280714	missense	probably benign
IGL01792:Ift172	APN	5	31276871	missense	probably damaging	1.00
IGL01830:Ift172	APN	5	31285292	missense	probably damaging	1.00
IGL01839:Ift172	APN	5	31266350	missense	probably damaging	1.00
IGL02007:Ift172	APN	5	31286604	missense	probably benign	0.17
IGL02172:Ift172	APN	5	31281337	splice site	probably benign
IGL02190:Ift172	APN	5	31254458	missense	possibly damaging	0.51
IGL02334:Ift172	APN	5	31283058	missense	probably benign	0.00
IGL02486:Ift172	APN	5	31257583	missense	probably damaging	1.00
IGL02517:Ift172	APN	5	31253648	splice site	probably null
IGL02571:Ift172	APN	5	31257891	missense	probably damaging	1.00
IGL02626:Ift172	APN	5	31264496	missense	probably benign
IGL03183:Ift172	APN	5	31272004	missense	probably benign	0.06
IGL03277:Ift172	APN	5	31267298	missense	possibly damaging	0.92
IGL03349:Ift172	APN	5	31284130	missense	probably benign	0.05
ostinato	UTSW	5	31276940	missense	probably benign	0.10
pushback	UTSW	5	31286945	missense	probably damaging	1.00
P0042:Ift172	UTSW	5	31261455	missense	probably benign	0.35
PIT4802001:Ift172	UTSW	5	31285266	missense	probably benign	0.03
R0153:Ift172	UTSW	5	31260624	missense	probably benign
R0328:Ift172	UTSW	5	31263851	nonsense	probably null
R0357:Ift172	UTSW	5	31257900	missense	possibly damaging	0.51
R0369:Ift172	UTSW	5	31253641	missense	probably damaging	1.00
R0391:Ift172	UTSW	5	31286667	missense	probably damaging	1.00
R0512:Ift172	UTSW	5	31285477	missense	possibly damaging	0.92
R0546:Ift172	UTSW	5	31257601	missense	probably benign	0.14
R0553:Ift172	UTSW	5	31275842	splice site	probably benign
R0606:Ift172	UTSW	5	31254313	missense	probably damaging	0.99
R0834:Ift172	UTSW	5	31257371	missense	probably benign
R0973:Ift172	UTSW	5	31265355	missense	probably benign
R0973:Ift172	UTSW	5	31257918	unclassified	probably benign
R1189:Ift172	UTSW	5	31285830	critical splice acceptor site	probably null
R1205:Ift172	UTSW	5	31285792	missense	probably benign
R1289:Ift172	UTSW	5	31280976	missense	probably damaging	0.98
R1342:Ift172	UTSW	5	31261866	missense	probably benign
R1395:Ift172	UTSW	5	31285238	unclassified	probably benign
R1417:Ift172	UTSW	5	31256649	missense	probably damaging	1.00
R2020:Ift172	UTSW	5	31267241	nonsense	probably null
R2111:Ift172	UTSW	5	31286079	missense	probably benign	0.04
R2175:Ift172	UTSW	5	31266685	missense	probably damaging	1.00
R2509:Ift172	UTSW	5	31262968	missense	probably benign
R2870:Ift172	UTSW	5	31257861	missense	probably benign	0.00
R2870:Ift172	UTSW	5	31257861	missense	probably benign	0.00
R2871:Ift172	UTSW	5	31257861	missense	probably benign	0.00
R2872:Ift172	UTSW	5	31257861	missense	probably benign	0.00
R2872:Ift172	UTSW	5	31257861	missense	probably benign	0.00
R3705:Ift172	UTSW	5	31261437	critical splice donor site	probably null
R3793:Ift172	UTSW	5	31257581	missense	possibly damaging	0.61
R4385:Ift172	UTSW	5	31286967	missense	probably damaging	1.00
R4477:Ift172	UTSW	5	31265437	missense	probably benign	0.38
R4590:Ift172	UTSW	5	31253955	missense	probably damaging	1.00
R4663:Ift172	UTSW	5	31284215	missense	probably benign	0.01
R4665:Ift172	UTSW	5	31285254	missense	possibly damaging	0.82
R4977:Ift172	UTSW	5	31272116	missense	possibly damaging	0.79
R5109:Ift172	UTSW	5	31265986	missense	probably benign	0.06
R5182:Ift172	UTSW	5	31267614	missense	possibly damaging	0.51
R5343:Ift172	UTSW	5	31263812	missense	probably benign	0.05
R5465:Ift172	UTSW	5	31261518	splice site	probably null
R5622:Ift172	UTSW	5	31283082	missense	probably damaging	1.00
R5718:Ift172	UTSW	5	31255277	missense	possibly damaging	0.94
R5793:Ift172	UTSW	5	31276948	missense	possibly damaging	0.96
R5870:Ift172	UTSW	5	31276940	missense	probably benign	0.10
R5919:Ift172	UTSW	5	31260662	missense	possibly damaging	0.63
R5968:Ift172	UTSW	5	31261484	missense	probably damaging	1.00
R6112:Ift172	UTSW	5	31256897	missense	probably benign
R6339:Ift172	UTSW	5	31256583	missense	probably benign	0.00
R6339:Ift172	UTSW	5	31286945	missense	probably damaging	1.00
R6355:Ift172	UTSW	5	31284157	missense	probably benign	0.33
R6565:Ift172	UTSW	5	31275883	missense	possibly damaging	0.68
R6668:Ift172	UTSW	5	31255339	missense	probably benign	0.00
R6755:Ift172	UTSW	5	31260998	nonsense	probably null
R6818:Ift172	UTSW	5	31265960	missense	probably benign	0.01
R6939:Ift172	UTSW	5	31257586	missense	probably damaging	1.00
R6980:Ift172	UTSW	5	31257386	missense	probably benign
R7047:Ift172	UTSW	5	31275894	nonsense	probably null
R7156:Ift172	UTSW	5	31272075	missense	probably damaging	1.00
R7180:Ift172	UTSW	5	31254262	missense	probably damaging	1.00
R7288:Ift172	UTSW	5	31285286	missense	probably damaging	1.00
R7351:Ift172	UTSW	5	31275896	missense	probably damaging	1.00
R7706:Ift172	UTSW	5	31266379	nonsense	probably null
R7890:Ift172	UTSW	5	31283081	nonsense	probably null
R7980:Ift172	UTSW	5	31260644	missense	probably benign
R8263:Ift172	UTSW	5	31265337	missense	possibly damaging	0.48
R8559:Ift172	UTSW	5	31256577	missense	probably damaging	0.98
R8717:Ift172	UTSW	5	31255641	missense	probably benign	0.00
R8774:Ift172	UTSW	5	31257863	missense	probably benign	0.45
R8774-TAIL:Ift172	UTSW	5	31257863	missense	probably benign	0.45
R9037:Ift172	UTSW	5	31263056	missense	possibly damaging	0.56
R9038:Ift172	UTSW	5	31284055	missense	possibly damaging	0.53
R9133:Ift172	UTSW	5	31285523	missense	probably benign	0.00
R9607:Ift172	UTSW	5	31253569	missense
X0022:Ift172	UTSW	5	31285320	missense	probably damaging	0.97
Z1176:Ift172	UTSW	5	31276924	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAAATGATCTTTCCATGTGACGC -3'
(R):5'- CTGAAGAGCTGTTAGCCAGG -3'

Sequencing Primer
(F):5'- ACGCAGTGGTCTTCCCC -3'
(R):5'- ACGAGCCAGGCTTCCATG -3'

Posted On

2014-12-04