Incidental Mutation 'R2871:Mlxip'
ID253714
Institutional Source Beutler Lab
Gene Symbol Mlxip
Ensembl Gene ENSMUSG00000038342
Gene NameMLX interacting protein
SynonymsMondoa, bHLHe36, Mir
MMRRC Submission 040459-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R2871 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123394798-123457932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123452667 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 878 (M878V)
Ref Sequence ENSEMBL: ENSMUSP00000064943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068237]
Predicted Effect probably benign
Transcript: ENSMUST00000068237
AA Change: M878V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064943
Gene: ENSMUSG00000038342
AA Change: M878V

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 27 44 N/A INTRINSIC
low complexity region 47 73 N/A INTRINSIC
PDB:4GNT|B 157 177 8e-7 PDB
low complexity region 347 363 N/A INTRINSIC
low complexity region 436 467 N/A INTRINSIC
low complexity region 514 539 N/A INTRINSIC
low complexity region 557 570 N/A INTRINSIC
low complexity region 632 643 N/A INTRINSIC
low complexity region 686 704 N/A INTRINSIC
HLH 723 773 2.81e-9 SMART
low complexity region 880 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135961
SMART Domains Protein: ENSMUSP00000120510
Gene: ENSMUSG00000038342

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 132 150 N/A INTRINSIC
HLH 169 219 2.81e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199458
Meta Mutation Damage Score 0.1325 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as part of a heterodimer to activate transcription. The encoded protein forms a heterodimer with Max-like protein X (MLX) and is involved in the regulation of genes in response to cellular glucose levels. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Akap8l G A 17: 32,338,442 T65I possibly damaging Het
Arid4a T A 12: 71,022,260 probably null Het
Armc2 C T 10: 41,966,700 probably null Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cfap54 A T 10: 92,921,419 F273I possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Ddrgk1 T A 2: 130,664,644 probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eml5 C T 12: 98,865,401 D433N probably damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Kcnk10 T A 12: 98,434,813 R520S probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lpo A G 11: 87,816,524 I221T possibly damaging Het
Lrrn3 T C 12: 41,452,723 I532V probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a C A 1: 88,255,565 L1292I probably damaging Het
Msh2 C A 17: 87,685,584 Q314K possibly damaging Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Npas3 C T 12: 54,068,013 R542* probably null Het
Olfr1101 A T 2: 86,988,848 C109* probably null Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr45 A G 7: 140,691,285 I127V possibly damaging Het
Olfr71 C A 4: 43,706,458 V37L probably benign Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Pkp4 C A 2: 59,308,156 T250K probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Rps6kc1 T C 1: 190,899,569 I48M probably damaging Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vmn2r70 T A 7: 85,559,019 Y750F probably damaging Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Mlxip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Mlxip APN 5 123447205 missense probably benign 0.35
IGL00922:Mlxip APN 5 123440065 missense probably damaging 1.00
IGL01138:Mlxip APN 5 123450156 missense probably damaging 1.00
IGL01624:Mlxip APN 5 123395329 missense probably benign 0.08
IGL02155:Mlxip APN 5 123453392 missense probably benign
IGL03011:Mlxip APN 5 123445951 missense probably benign 0.01
IGL03177:Mlxip APN 5 123445981 missense possibly damaging 0.86
IGL03242:Mlxip APN 5 123440061 missense probably damaging 1.00
confutatis UTSW 5 123442449 splice site probably null
BB008:Mlxip UTSW 5 123450495 missense probably damaging 1.00
BB018:Mlxip UTSW 5 123450495 missense probably damaging 1.00
PIT4366001:Mlxip UTSW 5 123395110 missense probably benign 0.00
R0136:Mlxip UTSW 5 123442306 missense probably damaging 1.00
R1583:Mlxip UTSW 5 123450223 missense possibly damaging 0.86
R2410:Mlxip UTSW 5 123443069 missense probably damaging 1.00
R2869:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2869:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2870:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2870:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2871:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2873:Mlxip UTSW 5 123452667 missense probably benign 0.04
R2962:Mlxip UTSW 5 123440824 missense probably damaging 0.99
R3709:Mlxip UTSW 5 123447474 missense probably benign 0.00
R4512:Mlxip UTSW 5 123395065 missense probably benign
R4536:Mlxip UTSW 5 123450503 missense probably damaging 0.97
R4722:Mlxip UTSW 5 123447202 missense probably benign 0.39
R4993:Mlxip UTSW 5 123395294 missense probably damaging 1.00
R5503:Mlxip UTSW 5 123395327 missense probably damaging 0.98
R5715:Mlxip UTSW 5 123440058 missense probably damaging 1.00
R6006:Mlxip UTSW 5 123445658 missense possibly damaging 0.93
R6330:Mlxip UTSW 5 123394952 missense probably benign
R6617:Mlxip UTSW 5 123442449 splice site probably null
R6709:Mlxip UTSW 5 123447276 missense possibly damaging 0.89
R6970:Mlxip UTSW 5 123445672 missense possibly damaging 0.52
R7718:Mlxip UTSW 5 123445514 missense probably benign 0.00
R7931:Mlxip UTSW 5 123450495 missense probably damaging 1.00
R8222:Mlxip UTSW 5 123447533 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGCAGTCAACCTGGCTTG -3'
(R):5'- CTGCTGAAAGCTTTCTGGATTC -3'

Sequencing Primer
(F):5'- AGTCAACCTGGCTTGCCTGAG -3'
(R):5'- GAAAGCTTTCTGGATTCTAGGATCCC -3'
Posted On2014-12-04